<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29635?offset=1070</link>
	<atom:link href="https://bioinformaticsonline.com/related/29635?offset=1070" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/43044/kanthida-lab</guid>
  <pubDate>Wed, 28 Apr 2021 02:27:22 -0500</pubDate>
  <link></link>
  <title><![CDATA[Kanthida Lab !]]></title>
  <description><![CDATA[
<p>Research Interest: </p>

<p>Bioinformatics </p>

<p>High-throughput and high-dimensional data analysis</p>

<p>Microbiome data analysis (Main focus)</p>

<p>Next-generation and third-generation sequencing data analysis for genomics</p>

<p>Gene expression data analysis</p>

<p>Machine learning for biological data</p>

<p>Biomarkers identification </p>

<p>Database and web-application for biological data</p>

<p>More at <br />https://sites.google.com/mail.kmutt.ac.th/kanthida-k/home?authuser=0</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4873/vveks-lab</guid>
  <pubDate>Thu, 26 Sep 2013 11:11:39 -0500</pubDate>
  <link></link>
  <title><![CDATA[Vvek's Lab]]></title>
  <description><![CDATA[
<p>Broad Area of Research: RNA biology (microRNA, lncRNA), Stem cells, Functional genomics, Epigenomics and Cancer</p>

<p>RNAs, especially non-coding RNAs (such as microRNA, long ncRNAs) are recently identified to be very abundant in mammalian organisms and play some key roles in gene expression regulation, gene silencing, and also implicated in disease progression, stem cell pluripotency etc. Current research activities of our lab include analysis of expression pattern of ncRNAs by microarray and next-gen sequencing data and understanding the role of miRNAs or other regulatory RNAs in various diseases, especially cancer and validation by reporter assays (renilla/luciferase) and other experimental tools.</p>

<p>More @ http://vvekslab.in/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</guid>
	<pubDate>Fri, 27 Aug 2021 01:31:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</link>
	<title><![CDATA[biostarhandbook]]></title>
	<description><![CDATA[<p>Nice book collection for bioinformatician ... highly recommended.</p><p>Address of the bookmark: <a href="https://www.biostarhandbook.com/" rel="nofollow">https://www.biostarhandbook.com/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/5462/showreel-2008-cortical-studios</guid>
	<pubDate>Sat, 12 Oct 2013 18:33:40 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/5462/showreel-2008-cortical-studios</link>
	<title><![CDATA[Showreel 2008 - Cortical Studios]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/qrReqMKe7Xg" frameborder="0" allowfullscreen></iframe>We are a bioinformatics company that combines 3D animation, multimedia and scientific knowledge to meet your communication needs. With our academic background in the fields of biotechnology and molecular cellbiology and our computer expertise we provide cutting edge 3D animation productions for even the most complex projects. We translate complex scientific information into comprehensible artistic imagery in order to improve communication in the life sciences. Please feel free to contact us with any questions regarding the possibilities for your unique project.

Cortical Studios
Keizersgracht 8
1015 CN
Amsterdam
The Netherlands
info@corticalstudios.nl
www.corticalstudios.nl]]></description>
	
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/44400/pevzner-lab</guid>
  <pubDate>Thu, 02 Nov 2023 05:39:26 -0500</pubDate>
  <link></link>
  <title><![CDATA[Pevzner Lab !]]></title>
  <description><![CDATA[
<p>The laboratory works on genome sequencing, immunoproteogenomics, antibiotics sequencing, and comparative genomics - computational technologies that enabled new applications and allowed scientists to attack biological problems that remained beyond the reach of previous techniques.</p>

<p>https://bioalgorithms.ucsd.edu/research4.html</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7813/research-associate-indian-institute-of-spices-research</guid>
  <pubDate>Wed, 08 Jan 2014 10:10:03 -0600</pubDate>
  <link></link>
  <title><![CDATA[Research Associate @ INDIAN INSTITUTE OF SPICES RESEARCH]]></title>
  <description><![CDATA[
<p>INDIAN INSTITUTE OF SPICES RESEARCH<br />(Indian Council of Agricultural Research)<br />Marikunnu P.O., Kozhikode – 673 012, Kerala</p>

<p>Phone No. 0495 2731 410</p>

<p>WALK -IN- TEST CUM INTERVIEW<br />Walk- in- Test cum Interview (based on test) for the selection of Research Associate (Bioinformatics) &amp; Bioinformatic Trainees under the scheme ‘Distributed Information Sub Centre- DISC’ will be held at this Institute as per details indicated below.</p>

<p>Research Associate<br />Date of Interview : 21 -01-2014 at 10.00 A.M<br />Qualifications :<br />a) Essential: Doctorate degree in Bioinformatics or Biotechnology/Life Sciences/Biochemistry with expertise in  Bioinformatics as evidenced by publications.<br />OR Three years research experience after  MVSc/MPharm/ME/MTech with Bioinformatics Specialization.<br />b Desirable: Experience in handling NGS data  Programming skills in Python/Bioperl<br />Emoluments : Rs:22000/- per month + HRA  (higher pay upto Rs.24000/- can be paid depending on the qualifications and experience.<br />Upper age limit : 40 years for Men &amp; 45 years for Women as on date of Interview (Upper Age limits are relaxable for SC, ST and OBC candidates as per Govt. of India norms (at present 5 years for SC/ST and 3 years for OBC)<br />Duration of Project : Till the closure of the project.</p>

<p>General Terms and conditions<br />1. The above positions are purely on temporary basis and is co-terminus with the closure of the project. There is no provision of re-employment after termination of project.<br />The selected candidate will not have any right for claiming pay scale or absorption<br />against any regular post being vacant on a later date at this Institute.<br />2 . No TA/DA will be paid for attending the Interview.<br />3. Canvassing in any form will lead to cancellation of candidate.<br />4. The decision of Director, IISR would be final and binding in all aspects.<br />5. Candidates will not be permitted to enter the Examination Hall after 10.00 A.M.<br />6. Candidates who secure the minimum marks prescribed by the Institute in written test  only will be eligible for calling for the interview. The number of candidates to be  called for the interview will be decided by the Director of the Institute.<br />7 Those who do not possess original Degree/PG certificate or Provisional certificate will not be allowed to attend the Test/Interview.</p>

<p>Note: All relevant certificates (in original) and bio data, No objection certificate in case he/she is employed elsewhere and experience certificate in original (if any) need to be produced at the time of interview.<br />Advertisement: http://spicebioinfo.res.in/downloads/DISC-Website.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34925/rectangle-graph-for-repeat-resolution-in-genome-assembly</guid>
	<pubDate>Thu, 28 Dec 2017 09:43:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34925/rectangle-graph-for-repeat-resolution-in-genome-assembly</link>
	<title><![CDATA[Rectangle Graph for Repeat Resolution in Genome Assembly]]></title>
	<description><![CDATA[<p>Ultimate tool for resolving repeats in genome assemblies.</p>
<p>Though the specific implementation of the idea of the rectangle graph approach is already included into the&nbsp;<a href="http://bioinf.spbau.ru/spades">current SPAdes distribution</a>, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.</p>
<p>For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner.&nbsp;<a href="http://www.springerlink.com/content/e617788h25u36440/">From de Bruijn Graphs to Rectangle Graphs for Genome Assembly</a>,&nbsp;<em>Lecture Notes in Bioinformatics</em>&nbsp;7534 (2012), pp. 249-261.</p><p>Address of the bookmark: <a href="http://bioinf.spbau.ru/en/rectangles" rel="nofollow">http://bioinf.spbau.ru/en/rectangles</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4947/experimental-scientific-officer-bioinformatics</guid>
  <pubDate>Fri, 27 Sep 2013 11:09:44 -0500</pubDate>
  <link></link>
  <title><![CDATA[Experimental Scientific Officer (Bioinformatics)]]></title>
  <description><![CDATA[
<p>Closing Date:  8 October 2013</p>

<p>Salary:   £27,854 - £29,541, with progression to £36,298</p>

<p>You will perform cutting edge computational biology within the Faculty of Medical Sciences, with a particular focus on the Northern Institute for Cancer Research (NICR), and contribute to the delivery of Faculty wide programmes of training, analytical services and skill transfer between Faculty Institutes.</p>

<p>You will have a relevant first degree or equivalent qualifications and/or experience in a relevant scientific/technical role, together with previous specialist experience at a senior level in bioinformatics. A PhD is desirable.</p>

<p>This position is part of the Bioinformatics Support Unit but physically located for the majority of the time in the NICR buildings.</p>

<p>Tenable for three years.</p>

<p>Informal enquiries to unit head Dr Simon Cockell: 0191 222 7253; simon.cockell@ncl.ac.uk</p>

<p>For more information visit @ https://www15.i-grasp.com/fe/tpl_newcastle02.asp?s=4A515F4E5A565B1A&amp;jobid=50667,2552984041&amp;key=70203469&amp;c=725434237887&amp;pagestamp=sepghtjhowdqpsxuyn</p>

<p>You can also find several other jobs @http://bsu.ncl.ac.uk/support/recruitment/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40713/glia-a-graphsmith-waterman-partial-order-alignerrealigner</guid>
	<pubDate>Tue, 28 Jan 2020 04:02:58 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40713/glia-a-graphsmith-waterman-partial-order-alignerrealigner</link>
	<title><![CDATA[Glia: a Graph/Smith-Waterman (partial order) aligner/realigner]]></title>
	<description><![CDATA[<p><span>glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.&nbsp;</span></p>
<p><span>More at&nbsp;<a href="https://github.com/ekg/glia">https://github.com/ekg/glia</a></span></p>
<pre><code>glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA</code></pre><p>Address of the bookmark: <a href="https://github.com/ekg/glia" rel="nofollow">https://github.com/ekg/glia</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/5220/paolo-ruggerone-lab</guid>
  <pubDate>Tue, 01 Oct 2013 14:15:53 -0500</pubDate>
  <link></link>
  <title><![CDATA[Paolo Ruggerone Lab]]></title>
  <description><![CDATA[
<p>Efflux pumps (RND family)</p>

<p>Functioning of efflux systems in Gram-negative bacteria<br />Determinants of the compound-efflux system interactions<br />Action of inhibitors on efflux systems<br />Structural and dynamical features of the efflux systems</p>

<p>TatA<br />Assembly of the TatA system<br />Study of the dynamical features of the charge zipper</p>

<p>Methods<br />Setup of a kinetic Monte Carlo (KMC) scheme to study the flux of antibiotics through porins and efflux systems<br />Setup of protocol to integrate MD results in a ligand-based approach</p>

<p>Viral inhibitors<br />Interactions of selected compounds with RNA-dependent RNA polymerases (RdRps) of HCV and BVDV<br />Assessment of the role of mutations in RdRps<br />Antimicrobial peptides</p>

<p>Interactions of antimicrobial peptides with membranes: structure and dynamics<br />Interactions between antimicrobial peptides in the presence of different membranes<br />Protein-protein interactions<br />Effects of mutations</p>

<p>Lab Page<br />http://www.dsf.unica.it/~paolo/Site/Home.html</p>
]]></description>
</item>

</channel>
</rss>