You might learn a lot about that house—the rooms, the doors, the furniture—but you would miss the bigger story: the streets, the neighborhoods, and all the ways the city changes from one place to another.

Something similar happens when scientists study bacterial genomes one at a time.

Over the past decade, researchers have collected thousands of bacterial genomes. These genomes contain an enormous amount of information about how bacteria survive, adapt, and evolve. But comparing thousands of individual genomes can quickly become a computational maze.

That is where PANORAMA enters the story.

Developed by Jérôme Arnoux and colleagues, PANORAMA is a computational tool designed to explore bacterial pangenomes—the complete collection of genetic possibilities found across a species or group of related organisms. Instead of looking at every genome as an isolated object, the approach represents their shared and variable genetic features as a graph.

Think of this graph as a giant subway map.

Some stations appear on almost every route. These represent genes that are highly conserved. Other stations appear only on certain routes, representing genes that some bacteria possess while others do not. By looking at the entire network, scientists can begin to see not just *what genes exist*, but how they are organized and how biological systems are distributed across populations.

The researchers put PANORAMA to the test using 941 genomes of Pseudomonas aeruginosa, a bacterium important in human health. They used the tool to investigate biological systems, including bacterial defense mechanisms against viruses known as bacteriophages. They then expanded the analysis to more than 6,000 genomes from four Enterobacteriaceae species.

The result is more than a faster way to process data.

PANORAMA allows researchers to ask a bigger question: What can an entire microbial species do, genetically speaking?

By comparing pangenomes, the researchers could identify systems shared between species as well as distinctive features. They could also find recurring genomic locations where genetic material is inserted—clues that may reveal common evolutionary processes.

And this is perhaps the most exciting part of the story.

Every bacterial genome is like a page in a huge evolutionary book. Until recently, reading thousands of those pages together was difficult. PANORAMA provides a way to turn those pages into a map, allowing scientists to see patterns that might disappear when each genome is studied separately.

The study, published in PLOS Computational Biology in July 2026, presents PANORAMA as a foundation for large-scale comparative pangenomics. The software and accompanying analysis resources are openly available, giving other researchers the opportunity to explore microbial diversity themselves.

So the story is not really about one bacterium or one genome.

It is about changing the way we look at life.

Instead of asking, “What is inside this genome?”, scientists can increasingly ask, “What is the full genetic landscape of this species—and how did it become this way?”

And sometimes, when you stop looking at one house and finally see the whole city, the most interesting discoveries are hiding in the streets between them.

Read more at https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1013856

A recent study by Webster and Chapman introduces Buscogeny (https://github.com/Jwebster89/Buscogeny), an open-source bioinformatics pipeline designed to make this process easier. The tool uses BUSCO (Benchmarking Universal Single-Copy Orthologs), which identifies conserved genes that are expected to occur as single copies in particular groups of organisms. These genes act like evolutionary landmarks, allowing researchers to compare genomes and investigate their relationships.

Buscogeny brings several steps of phylogenomic analysis into one workflow. It identifies BUSCO genes, extracts and aligns their sequences, removes unreliable regions, combines information from multiple genes, and uses the resulting data to construct a phylogenetic tree. It also provides quality-control information, helping researchers identify genomes that may be too incomplete for reliable analysis.

The authors demonstrate the usefulness of Buscogeny with bacterial and fungal genomes, including Alternaria. This is particularly valuable because fungal genomes can vary greatly in quality and annotation. Ultimately, Buscogeny helps transform massive amounts of genomic data into an understandable evolutionary story. Each DNA sequence becomes a clue, each conserved gene becomes a landmark, and together these clues reveal a picture of how life is connected.

More at https://link.springer.com/article/10.1007/s10123-025-00752-6?

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

1) expression-based heat maps from transcriptomic, proteomic and metabolomic experiments; 2) pairwise distance maps;

3) correlation maps;

4) image overlay heat maps;

5) latitude and longitude heat maps and

6) geopolitical (choropleth) heat maps.

Heatmapper offers a number of simple and intuitive customization options for easy adjustments to each heat map’s appearance and plotting parameters. Heatmapper also allows users to interactively explore their numeric data values by hovering their cursor over each heat map, or by using a searchable/sortable data table view.

Ref https://www.ncbi.nlm.nih.gov/pubmed/27190236

Address of the bookmark: http://www2.heatmapper.ca/

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Magic-BLAST incorporates within the NCBI BLAST code framework ideas developed in the NCBI Magic pipeline, in particular hit extensions by local walk and jump (http://www.ncbi.nlm.nih.gov/pubmed/26109056), and recursive clipping of mismatches near the edges of the reads, which avoids accumulating artefactual mismatches near splice sites and is needed to distinguish short indels from substitutions near the edges.

Address of the bookmark: https://ncbi.github.io/magicblast/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Is this available, or still under trial mode? 

https://www.nanoporetech.com/

https://www.nanoporetech.com/technology/the-minion-device-a-miniaturised-sensing-system/the-minion-device-a-miniaturised-sensing-system