BOL: Related items

Research Fellows at AIMSCS, Hyderabad

Wed, 06 May 2015 06:23:33 -0500

C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS) - Hyderabad, Andhra Pradesh
Advertisement No.: 5/2015

Research Fellows Systems Biology job vacancy in C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS)

JRF : Qualification - M. Sc in Bioinformatics, Systems Biology, M. Sc statistics, or M. Tech in Bioinformatics,

Pay Scale : Rs. 25,000

SRF : Qualification- Qualification prescribed for JRF with 2 years of research experience.

Pay Scale : Rs. 28,000*

No.of Post: 2

Desirable: Candidates should have strong background in Computational biology, bioinformatics, statistics and algorithmic development. In addition to that previous experience of working on Linux, bio-informatics, NGS data analysis and Basic knowledge of biology is desirable. Programming on any one of the programming languages (C, C++, perl, python) and statistical framework (e.g. R, matlab, etc.) is highly desirable.

More at http://www.crraoaimscs.org/jrf_application_form_2015.pdf

OMTools: a software package for visualizing and processing optical mapping data

BioJoker — Fri, 29 Mar 2019 01:21:54 -0500

OMTools, an efficient and intuitive data processing and visualization suite to handle and explore large-scale optical mapping profiles. OMTools includes modules for visualization (OMView), data processing and simulation. These modules together form an accessible and convenient pipeline for optical mapping analyses.

https://github.com/TF-Chan-Lab/OMTools

Address of the bookmark: https://github.com/TF-Chan-Lab/OMTools

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

FUMA GWAS: Functional Mapping and Annotation of Genome-Wide Association Studies

Jit — Sat, 01 Jun 2019 03:11:16 -0500

FUMA is a platform that can be used to annotate, prioritize, visualize and interpret GWAS results.
The SNP2GENE function takes GWAS summary statistics as an input, and provides extensive functional annotation for all SNPs in genomic areas identified by lead SNPs.
The GENE2FUNC function takes a list of gene IDs (as identified by SNP2GENE or as provided manually) and annotates genes in biological context

Address of the bookmark: https://fuma.ctglab.nl/

Next Generation Sequencing (NGS) Tutorials

Jitendra Narayan — Sat, 24 Aug 2013 06:01:37 -0500

Institute of computational biomedicine, Cornell University provide an NGS workshop tutorial at http://chagall.med.cornell.edu/NGScourse/

You can also add your favourite NGS educational material, or workshop tutorial by commenting on this bookmarks for user benefit.

Understanding the basics of genome sequencing:

Tutorial by Luke Jostins.

http://www.genetic-inference.co.uk/blog/2009/04/basics-sequencing-dna-part-1/

http://www.genetic-inference.co.uk/blog/2009/08/basics-sequencing-dna-part-2/

A window into third-generation sequencing

http://hmg.oxfordjournals.org/content/19/R2/R227.full.pdf

==============================================

NGS data analysis pipelines

Detecting and annotating genetic variations using the HugeSeq pipeline DOI: 10.1038/nbt.2134
NARWHAL, a primary analysis pipeline for NGS data http://bioinformatics.oxfordjournals.org/cgi/content/abstract/28/2/284?etoc
RseqFlow: Workflows for RNA-Seq data analysis DOI: 10.1093/bioinformatics/btr441
ngs_backbone: a pipeline for read cleaning, mapping and SNP calling using Next Generation Sequence 10.1186/1471-2164-12-285
A framework for variation discovery and genotyping using next-generation DNA sequencing data PubMed: 21478889
SNiPlay: a web-based tool for detection, management and analysis of SNPs. Application to grapevine diversity projects DOI: 10.1186/1471-2105-12-134 Abstract: http://www.biomedcentral.com/1471-2105/12/134/abstract
WEP: a high-performance analysis pipeline for whole-exome data http://www.biomedcentral.com/1471-2105/14/S7/S11
DDBJ read annotation pipeline: a cloud computing-based pipeline for high-throughput analysis of next-generation sequencing data. http://www.ncbi.nlm.nih.gov/pubmed/23657089
GATK: a Toolkit for Genome Analysis http://www.broadinstitute.org/gatk/
Metagenomics:http://www.nbic.nl/education/nbic-phd-school/course-schedule/ngsmetagenomics/
RNASeq:http://www.nbic.nl/education/nbic-phd-school/course-schedule/ngsrnaseq/
Bioinformatics and Seq courses: http://www.isb-sib.ch/training/training-activities-schedule/archive-2013.html
Variant Detection (Model organism) Advanced tutorial https://docs.google.com/document/pub?id=1CuKkKylVDb03tnN7RSWl5EUzleetn0ctjmvaidPKLxM
Variant Detection Introductory tutorial https://docs.google.com/document/pub?id=1ZRzrjjOCvtAu3m-IKL-rbJ1f4On60dDL_IEwG7oejdI
Microbial de novo Assembly for Illumina Data Introductory tutorial https://docs.google.com/document/pub?id=1N3AB9ptISUu4zULqe1kXpVF0BDyGb5f5yzxWSJd_WNM
RNAseq Differential Gene Expression Introductory tutorial https://docs.google.com/document/pub?id=1KbTiBHtvHLfPRZ39AY3uriazrINA8TJzgjjwn1zPP7Y

" Please add your favourite NGS link below in comment section for the benefit of bioinformatics community ".

Address of the bookmark: http://chagall.med.cornell.edu/NGScourse/

Rosenberg lab

Wed, 27 May 2015 17:52:24 -0500

Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

Scaffolding of a bacterial genome using MinION nanopore sequencing

Rahul Agarwal — Tue, 07 Jul 2015 16:59:25 -0500

Second generation sequencing has revolutionized genomic studies. However, most genomes contain repeated DNA elements that are longer than the read lengths achievable with typical sequencers, so the genomic order of several generated contigs cannot be easily resolved. A new generation of sequencers offering substantially longer reads is emerging, notably the Pacific Biosciences (PacBio) RS II system and the MinION system, released in early 2014 by Oxford Nanopore Technologies through an early access program.

Address of the bookmark: http://www.nature.com/srep/2015/150707/srep11996/full/srep11996.html

JRF Bioinformatics @ ICAR - National Research Centre for Orchids Pakyong

Thu, 28 May 2015 19:33:19 -0500

ICAR - National Research Centre for Orchids

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

GAM-NGS: genomic assemblies merger for next generation sequencing

Jit — Fri, 19 May 2017 07:44:14 -0500

GAM-NGS is a tool able to merge two or more assemblies in order to improve contiguity and correctness. It can be used on all NGS-based assembly projects and it shows its full potential with multi-library Illumina-based projects. With more than 20 available assemblers it is hard to select the best tool. In this context we propose a tool that improves assemblies (and, as a by-product, perhaps even assemblers) by merging them and selecting the generating that is most likely to be correct.

Address of the bookmark: https://github.com/vice87/gam-ngs

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}