<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29912?offset=320</link>
	<atom:link href="https://bioinformaticsonline.com/related/29912?offset=320" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22807/software-packages-for-next-gen-sequence-analysis</guid>
	<pubDate>Fri, 19 Jun 2015 21:07:15 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22807/software-packages-for-next-gen-sequence-analysis</link>
	<title><![CDATA[Software packages for next gen sequence analysis]]></title>
	<description><![CDATA[<p><strong>Integrated solutions</strong><br /> * <a href="http://www.clcbio.com/index.php?id=1240" target="_blank">CLCbio Genomics Workbench</a> - <em>de novo</em> and reference assembly of Sanger, Roche FLX, Illumina, Helicos, and SOLiD data. Commercial next-gen-seq software that extends the CLCbio Main Workbench software. Includes SNP detection, CHiP-seq, browser and other features. Commercial. Windows, Mac OS X and Linux.<br /> * <a href="http://g2.trac.bx.psu.edu/" target="_blank">Galaxy</a> - Galaxy = interactive and reproducible genomics. A job webportal.<br /> * <a href="http://www.genomatix.de/products/index.html" target="_blank">Genomatix</a> - Integrated Solutions for Next Generation Sequencing data analysis.<br /> * <a href="http://www.jmp.com/software/genomics/" target="_blank">JMP Genomics</a> - Next gen visualization and statistics tool from SAS. They are <a href="http://www.marketwatch.com/news/story/JMPR-Genomics-NCGR-Partnership-Foster/story.aspx?guid=%7B7AC9DE36-B6AA-4EDE-9CD5-633B29FE6154%7D" target="_blank">working with NCGR</a> to refine this tool and produce others.<br /> * <a href="http://softgenetics.com/NextGENe.html" target="_blank">NextGENe</a> - <em>de novo</em> and reference assembly of Illumina, SOLiD and Roche FLX data. Uses a novel Condensation Assembly Tool approach where reads are joined via "anchors" into mini-contigs before assembly. Includes SNP detection, CHiP-seq, browser and other features. Commercial. Win or MacOS.<br /> * <a href="http://www.dnastar.com/products/SMGA.php" target="_blank">SeqMan Genome Analyser</a> - Software for Next Generation sequence assembly of Illumina, Roche FLX and Sanger data integrating with Lasergene Sequence Analysis software for additional analysis and visualization capabilities. Can use a hybrid templated/de novo approach. Commercial. Win or Mac OS X.<br /> * <a href="http://1001genomes.org/downloads/shore.html" target="_blank">SHORE</a> - SHORE, for Short Read, is a mapping and analysis pipeline for short DNA sequences produced on a Illumina Genome Analyzer. A suite created by the 1001 Genomes project. Source for POSIX.<br /> * <a href="http://www.realtimegenomics.com/" target="_blank">SlimSearch</a> - Fledgling commercial product.<br /> <br /> <strong>Align/Assemble to a reference</strong><br /> * <a href="https://secure.genome.ucla.edu/index.php/BFAST" target="_blank">BFAST</a> - Blat-like Fast Accurate Search Tool. Written by Nils Homer, Stanley F. Nelson and Barry Merriman at UCLA.<br /> * <a href="http://bowtie-bio.sourceforge.net/" target="_blank">Bowtie</a> - Ultrafast, memory-efficient short read aligner. It aligns short DNA sequences (reads) to the human genome at a rate of 25 million reads per hour on a typical workstation with 2 gigabytes of memory. Uses a Burrows-Wheeler-Transformed (BWT) index. <a href="http://seqanswers.com/forums/showthread.php?t=706" target="_blank">Link to discussion thread here</a>. Written by Ben Langmead and Cole Trapnell. Linux, Windows, and Mac OS X.<br /> * <a href="http://maq.sourceforge.net/" target="_blank">BWA</a> - Heng Lee's BWT Alignment program - a progression from Maq. BWA is a fast light-weighted tool that aligns short sequences to a sequence database, such as the human reference genome. By default, BWA finds an alignment within edit distance 2 to the query sequence. C++ source.<br /> * <a href="http://bioinfo.cgrb.oregonstate.edu/docs/solexa/" target="_blank">ELAND</a> - Efficient Large-Scale Alignment of Nucleotide Databases. Whole genome alignments to a reference genome. Written by Illumina author Anthony J. Cox for the Solexa 1G machine.<br /> * <a href="http://www.ebi.ac.uk/%7Eguy/exonerate/" target="_blank">Exonerate</a> - Various forms of pairwise alignment (including Smith-Waterman-Gotoh) of DNA/protein against a reference. Authors are Guy St C Slater and Ewan Birney from EMBL. C for POSIX.<br /> * <a href="http://1001genomes.org/downloads/genomemapper.html" target="_blank">GenomeMapper</a> - GenomeMapper is a short read mapping tool designed for accurate read alignments. It quickly aligns millions of reads either with ungapped or gapped alignments. A tool created by the 1001 Genomes project. Source for POSIX.<br /> * <a href="http://www.gene.com/share/gmap/" target="_blank">GMAP</a> - GMAP (Genomic Mapping and Alignment Program) for mRNA and EST Sequences. Developed by Thomas Wu and Colin Watanabe at Genentec. C/Perl for Unix.<br /> * <a href="http://dna.cs.byu.edu/gnumap/" target="_blank">gnumap</a> - The Genomic Next-generation Universal MAPper (gnumap) is a program designed to accurately map sequence data obtained from next-generation sequencing machines (specifically that of Solexa/Illumina) back to a genome of any size. It seeks to align reads from nonunique repeats using statistics. From authors at Brigham Young University. C source/Unix.<br /> * <a href="http://sourceforge.net/projects/maq/" target="_blank">MAQ</a> - Mapping and Assembly with Qualities (renamed from MAPASS2). Particularly designed for Illumina with preliminary functions to handle ABI SOLiD data. Written by Heng Li from the Sanger Centre. Features extensive supporting tools for DIP/SNP detection, etc. C++ source<br /> * <a href="http://bioinformatics.bc.edu/marthlab/Mosaik" target="_blank">MOSAIK</a> - MOSAIK produces gapped alignments using the Smith-Waterman algorithm. Features a number of support tools. Support for Roche FLX, Illumina, SOLiD, and Helicos. Written by Michael Str&ouml;mberg at Boston College. Win/Linux/MacOSX<br /> * <a href="http://mrfast.sourceforge.net/" target="_blank">MrFAST and MrsFAST</a> - mrFAST &amp; mrsFAST are designed to map short reads generated with the Illumina platform to reference genome assemblies; in a fast and memory-efficient manner. Robust to INDELs and MrsFAST has a bisulphite mode. Authors are from the University of Washington. C as source.<br /> * <a href="http://mummer.sourceforge.net/" target="_blank">MUMmer</a> - MUMmer is a modular system for the rapid whole genome alignment of finished or draft sequence. Released as a package providing an efficient suffix tree library, seed-and-extend alignment, SNP detection, repeat detection, and visualization tools. Version 3.0 was developed by Stefan Kurtz, Adam Phillippy, Arthur L Delcher, Michael Smoot, Martin Shumway, Corina Antonescu and Steven L Salzberg - most of whom are at The Institute for Genomic Research in Maryland, USA. POSIX OS required.<br /> * <a href="http://www.novocraft.com/index.html" target="_blank">Novocraft</a> - Tools for reference alignment of paired-end and single-end Illumina reads. Uses a Needleman-Wunsch algorithm. Can support Bis-Seq. Commercial. Available free for evaluation, educational use and for use on open not-for-profit projects. Requires Linux or Mac OS X.<br /> * <a href="http://pass.cribi.unipd.it/cgi-bin/pass.pl" target="_blank">PASS</a> - It supports Illumina, SOLiD and Roche-FLX data formats and allows the user to modulate very finely the sensitivity of the alignments. Spaced seed intial filter, then NW dynamic algorithm to a SW(like) local alignment. Authors are from CRIBI in Italy. Win/Linux.<br /> * <a href="http://rulai.cshl.edu/rmap/" target="_blank">RMAP</a> - Assembles 20 - 64 bp Illumina reads to a FASTA reference genome. By Andrew D. Smith and Zhenyu Xuan at CSHL. (published in BMC Bioinformatics). POSIX OS required.<br /> * <a href="http://biogibbs.stanford.edu/%7Ejiangh/SeqMap/" target="_blank">SeqMap</a> - Supports up to 5 or more bp mismatches/INDELs. Highly tunable. Written by Hui Jiang from the Wong lab at Stanford. Builds available for most OS's.<br /> * <a href="http://compbio.cs.toronto.edu/shrimp/" target="_blank">SHRiMP</a> - Assembles to a reference sequence. Developed with Applied Biosystem's colourspace genomic representation in mind. Authors are Michael Brudno and Stephen Rumble at the University of Toronto. POSIX.<br /> * <a href="http://www.bcgsc.ca/platform/bioinfo/software/slider" target="_blank"><span style="text-decoration: underline;">Slider</span></a>- An application for the Illumina Sequence Analyzer output that uses the probability files instead of the sequence files as an input for alignment to a reference sequence or a set of reference sequences. Authors are from BCGSC. Paper is <a href="http://seqanswers.com/forums/showthread.php?t=740" target="_blank">here</a>.<br /> * <a href="http://soap.genomics.org.cn/" target="_blank">SOAP</a> - SOAP (Short Oligonucleotide Alignment Program). A program for efficient gapped and ungapped alignment of short oligonucleotides onto reference sequences. The updated version uses a BWT. Can call SNPs and INDELs. Author is Ruiqiang Li at the Beijing Genomics Institute. C++, POSIX.<br /> * <a href="http://www.sanger.ac.uk/Software/analysis/SSAHA/" target="_blank">SSAHA</a> - SSAHA (Sequence Search and Alignment by Hashing Algorithm) is a tool for rapidly finding near exact matches in DNA or protein databases using a hash table. Developed at the Sanger Centre by Zemin Ning, Anthony Cox and James Mullikin. C++ for Linux/Alpha.<br /> * <a href="http://socs.biology.gatech.edu/" target="_blank">SOCS</a> - Aligns SOLiD data. SOCS is built on an iterative variation of the Rabin-Karp string search algorithm, which uses hashing to reduce the set of possible matches, drastically increasing search speed. Authors are Ondov B, Varadarajan A, Passalacqua KD and Bergman NH.<br /> * <a href="http://bibiserv.techfak.uni-bielefeld.de/swift/welcome.html" target="_blank">SWIFT</a> - The SWIFT suit is a software collection for fast index-based sequence comparison. It contains: SWIFT &mdash; fast local alignment search, guaranteeing to find epsilon-matches between two sequences. SWIFT BALSAM &mdash; a very fast program to find semiglobal non-gapped alignments based on k-mer seeds. Authors are Kim Rasmussen (SWIFT) and Wolfgang Gerlach (SWIFT BALSAM)<br /> * <a href="http://synasite.mgrc.com.my:8080/sxog/NewSXOligoSearch.php" target="_blank">SXOligoSearch</a> - SXOligoSearch is a commercial platform offered by the Malaysian based <a href="http://www.synamatix.com/" target="_blank">Synamatix</a>. Will align Illumina reads against a range of Refseq RNA or NCBI genome builds for a number of organisms. Web Portal. OS independent.<br /> * <a href="http://www.vmatch.de/" target="_blank">Vmatch</a> - A versatile software tool for efficiently solving large scale sequence matching tasks. Vmatch subsumes the software tool REPuter, but is much more general, with a very flexible user interface, and improved space and time requirements. Essentially a large string matching toolbox. POSIX.<br /> * <a href="http://www.bioinformaticssolutions.com/products/zoom/index.php" target="_blank">Zoom</a> - ZOOM (Zillions Of Oligos Mapped) is designed to map millions of short reads, emerged by next-generation sequencing technology, back to the reference genomes, and carry out post-analysis. ZOOM is developed to be highly accurate, flexible, and user-friendly with speed being a critical priority. Commercial. Supports Illumina and SOLiD data.<br /> <br /> <strong><em>De novo</em> Align/Assemble</strong><br /> * <a href="http://www.bcgsc.ca/platform/bioinfo/software/abyss" target="_blank">ABySS</a> - Assembly By Short Sequences. ABySS is a de novo sequence assembler that is designed for very short reads. The single-processor version is useful for assembling genomes up to 40-50 Mbases in size. The parallel version is implemented using MPI and is capable of assembling larger genomes. By Simpson JT and others at the Canada's Michael Smith Genome Sciences Centre. C++ as source. <br /> * <a href="http://www.broad.mit.edu/science/programs/genome-biology/computational-rd/computational-research-and-development" target="_blank">ALLPATHS</a> - ALLPATHS: De novo assembly of whole-genome shotgun microreads. ALLPATHS is a whole genome shotgun assembler that can generate high quality assemblies from short reads. Assemblies are presented in a graph form that retains ambiguities, such as those arising from polymorphism, thereby providing information that has been absent from previous genome assemblies. Broad Institute.<br /> * <a href="http://www.genomic.ch/edena.php" target="_blank">Edena</a> - Edena (Exact DE Novo Assembler) is an assembler dedicated to process the millions of very short reads produced by the Illumina Genome Analyzer. Edena is based on the traditional overlap layout paradigm. By D. Hernandez, P. Fran&ccedil;ois, L. Farinelli, M. Osteras, and J. Schrenzel. Linux/Win.<br /> * <a href="http://euler-assembler.ucsd.edu/portal/" target="_blank">EULER-SR</a> - Short read <em>de novo</em> assembly. By Mark J. Chaisson and Pavel A. Pevzner from UCSD (published in Genome Research). Uses a de Bruijn graph approach.<br /> * <a href="http://chevreux.org/projects_mira.html" target="_blank">MIRA2</a> - MIRA (Mimicking Intelligent Read Assembly) is able to perform true hybrid de-novo assemblies using reads gathered through 454 sequencing technology (GS20 or GS FLX). Compatible with 454, Solexa and Sanger data. Linux OS required.<br /> * <a href="http://www.seqan.de/projects/consensus.html" target="_blank">SEQAN</a> - A Consistency-based Consensus Algorithm for De Novo and Reference-guided Sequence Assembly of Short Reads. By Tobias Rausch and others. C++, Linux/Win.<br /> * <a href="http://sharcgs.molgen.mpg.de/" target="_blank">SHARCGS</a> - De novo assembly of short reads. Authors are Dohm JC, Lottaz C, Borodina T and Himmelbauer H. from the Max-Planck-Institute for Molecular Genetics.<br /> * <a href="http://www.bcgsc.ca/platform/bioinfo/software/ssake" target="_blank">SSAKE</a> - The Short Sequence Assembly by K-mer search and 3' read Extension (SSAKE) is a genomics application for aggressively assembling millions of short nucleotide sequences by progressively searching for perfect 3'-most k-mers using a DNA prefix tree. Authors are Ren&eacute; Warren, Granger Sutton, Steven Jones and Robert Holt from the Canada's Michael Smith Genome Sciences Centre. Perl/Linux.<br /> * <a href="http://soap.genomics.org.cn/" target="_blank">SOAPdenovo</a> - Part of the SOAP suite. See above. <br /> * <a href="https://sourceforge.net/projects/vcake" target="_blank">VCAKE</a> - De novo assembly of short reads with robust error correction. An improvement on early versions of SSAKE.<br /> * <a href="http://www.ebi.ac.uk/%7Ezerbino/velvet/" target="_blank">Velvet</a> - Velvet is a de novo genomic assembler specially designed for short read sequencing technologies, such as Solexa or 454. Need about 20-25X coverage and paired reads. Developed by Daniel Zerbino and Ewan Birney at the European Bioinformatics Institute (EMBL-EBI). <br /> <br /> <strong>SNP/Indel Discovery</strong><br /> * <a href="http://www.sanger.ac.uk/Software/analysis/ssahaSNP/" target="_blank">ssahaSNP</a> - ssahaSNP is a polymorphism detection tool. It detects homozygous SNPs and indels by aligning shotgun reads to the finished genome sequence. Highly repetitive elements are filtered out by ignoring those kmer words with high occurrence numbers. More tuned for ABI Sanger reads. Developers are Adam Spargo and Zemin Ning from the Sanger Centre. Compaq Alpha, Linux-64, Linux-32, Solaris and Mac<br /> * <a href="http://bioinformatics.bc.edu/marthlab/PbShort" target="_blank">PolyBayesShort</a> - A re-incarnation of the PolyBayes SNP discovery tool developed by Gabor Marth at Washington University. This version is specifically optimized for the analysis of large numbers (millions) of high-throughput next-generation sequencer reads, aligned to whole chromosomes of model organism or mammalian genomes. Developers at Boston College. Linux-64 and Linux-32.<br /> * <a href="http://bioinformatics.bc.edu/marthlab/PyroBayes" target="_blank">PyroBayes</a> - PyroBayes is a novel base caller for pyrosequences from the 454 Life Sciences sequencing machines. It was designed to assign more accurate base quality estimates to the 454 pyrosequences. Developers at Boston College. <br /> <br /> <strong>Genome Annotation/Genome Browser/Alignment Viewer/Assembly Database</strong><br /> * <a href="http://bioinformatics.bc.edu/marthlab/EagleView" target="_blank">EagleView</a> - An information-rich genome assembler viewer. EagleView can display a dozen different types of information including base quality and flowgram signal. Developers at Boston College.<br /> * <a href="http://www.sanger.ac.uk/Software/analysis/lookseq/" target="_blank">LookSeq</a> - LookSeq is a web-based application for alignment visualization, browsing and analysis of genome sequence data. LookSeq supports multiple sequencing technologies, alignment sources, and viewing modes; low or high-depth read pileups; and easy visualization of putative single nucleotide and structural variation. From the Sanger Centre.<br /> * <a href="http://evolution.sysu.edu.cn/mapview/" target="_blank">MapView</a> - MapView: visualization of short reads alignment on desktop computer. From the Evolutionary Genomics Lab at Sun-Yat Sen University, China. Linux.<br /> * <a href="http://www.bcgsc.ca/platform/bioinfo/software/sam" target="_blank">SAM</a> - Sequence Assembly Manager. Whole Genome Assembly (WGA) Management and Visualization Tool. It provides a generic platform for manipulating, analyzing and viewing WGA data, regardless of input type. Developers are Rene Warren, Yaron Butterfield, Asim Siddiqui and Steven Jones at Canada's Michael Smith Genome Sciences Centre. MySQL backend and Perl-CGI web-based frontend/Linux. <br /> * <a href="http://staden.sourceforge.net/" target="_blank">STADEN</a> - Includes GAP4. GAP5 once completed will handle next-gen sequencing data. A partially implemented test version is available <a href="https://sourceforge.net/project/show...kage_id=256957" target="_blank">here</a><br /> * <a href="http://www.bcgsc.ca/platform/bioinfo/software/xmatchview" target="_blank">XMatchView</a> - A visual tool for analyzing cross_match alignments. Developed by Rene Warren and Steven Jones at Canada's Michael Smith Genome Sciences Centre. Python/Win or Linux.<br /> <br /> <strong>Counting e.g. CHiP-Seq, Bis-Seq, CNV-Seq</strong><br /> * <a href="http://epigenomics.mcdb.ucla.edu/BS-Seq/download.html" target="_blank">BS-Seq</a> - The source code and data for the "Shotgun Bisulphite Sequencing of the Arabidopsis Genome Reveals DNA Methylation Patterning" Nature paper by <a href="http://www.ncbi.nlm.nih.gov/sites/entrez?holding=&amp;db=pubmed&amp;cmd=search&amp;term=Shotgun%20Bisulphite%20Sequencing" target="_blank">Cokus et al.</a> (Steve Jacobsen's lab at UCLA). POSIX.<br /> * <a href="http://woldlab.caltech.edu/chipseq/" target="_blank">CHiPSeq</a> - Program used by Johnson et al. (2007) in their Science publication<br /> * <a href="http://tiger.dbs.nus.edu.sg/cnv-seq/" target="_blank">CNV-Seq</a> - CNV-seq, a new method to detect copy number variation using high-throughput sequencing. Chao Xie and Martti T Tammi at the National University of Singapore. Perl/R.<br /> * <a href="http://www.bcgsc.ca/platform/bioinfo/software/findpeaks" target="_blank">FindPeaks</a> - perform analysis of ChIP-Seq experiments. It uses a naive algorithm for identifying regions of high coverage, which represent Chromatin Immunoprecipitation enrichment of sequence fragments, indicating the location of a bound protein of interest. Original algorithm by Matthew Bainbridge, in collaboration with Gordon Robertson. Current code and implementation by Anthony Fejes. Authors are from the Canada's Michael Smith Genome Sciences Centre. JAVA/OS independent. Latest versions available as part of the <a href="http://vancouvershortr.sourceforge.net/" target="_blank">Vancouver Short Read Analysis Package</a><br /> * <a href="http://liulab.dfci.harvard.edu/MACS/" target="_blank">MACS</a> - Model-based Analysis for ChIP-Seq. MACS empirically models the length of the sequenced ChIP fragments, which tends to be shorter than sonication or library construction size estimates, and uses it to improve the spatial resolution of predicted binding sites. MACS also uses a dynamic Poisson distribution to effectively capture local biases in the genome sequence, allowing for more sensitive and robust prediction. Written by Yong Zhang and Tao Liu from Xiaole Shirley Liu's Lab. <br /> * <a href="http://www.gersteinlab.org/proj/PeakSeq/" target="_blank">PeakSeq</a> - PeakSeq: Systematic Scoring of ChIP-Seq Experiments Relative to Controls. a two-pass approach for scoring ChIP-Seq data relative to controls. The first pass identifies putative binding sites and compensates for variation in the mappability of sequences across the genome. The second pass filters out sites that are not significantly enriched compared to the normalized input DNA and computes a precise enrichment and significance. By Rozowsky J et al. C/Perl.<br /> * <a href="http://mendel.stanford.edu/sidowlab/downloads/quest/" target="_blank">QuEST</a> - Quantitative Enrichment of Sequence Tags. Sidow and Myers Labs at Stanford. From the 2008 publication <a href="http://www.ncbi.nlm.nih.gov/pubmed/18711362" target="_blank">Genome-wide analysis of transcription factor binding sites based on ChIP-Seq data</a>. (C++)<br /> * <a href="http://dir.nhlbi.nih.gov/papers/lmi/epigenomes/sissrs/" target="_blank">SISSRs</a> - Site Identification from Short Sequence Reads. BED file input. Raja Jothi @ NIH. Perl.<br /> **See also <a href="http://seqanswers.com/forums/showthread.php?t=742" target="_blank">this thread</a> for ChIP-Seq, until I get time to update this list.<br /> <br /> <strong>Alternate Base Calling</strong><br /> * <a href="http://svitsrv25.epfl.ch/R-doc/library/Rolexa/html/00Index.html" target="_blank">Rolexa</a> - R-based framework for base calling of Solexa data. Project <a href="http://www.biomedcentral.com/1471-2105/9/431" target="_blank">publication</a><br /> * <a href="http://hannonlab.cshl.edu/Alta-Cyclic/main.html" target="_blank">Alta-cyclic</a> - "a novel Illumina Genome-Analyzer (Solexa) base caller"<br /> <br /> <strong>Transcriptomics</strong><br /> * <a href="http://woldlab.caltech.edu/rnaseq/" target="_blank">ERANGE</a> - Mapping and Quantifying Mammalian Transcriptomes by RNA-Seq. Supports Bowtie, BLAT and ELAND. From the Wold lab.<br /> * <a href="http://www.genoscope.cns.fr/externe/gmorse/" target="_blank">G-Mo.R-Se</a> - G-Mo.R-Se is a method aimed at using RNA-Seq short reads to build de novo gene models. First, candidate exons are built directly from the positions of the reads mapped on the genome (without any ab initio assembly of the reads), and all the possible splice junctions between those exons are tested against unmapped reads. From CNS in France.<br /> * <a href="http://evolution.sysu.edu.cn/english/software/mapnext.htm" target="_blank">MapNext</a> - MapNext: A software tool for spliced and unspliced alignments and SNP detection of short sequence reads. From the Evolutionary Genomics Lab at Sun-Yat Sen University, China.<br /> * <a href="http://www.fml.tuebingen.mpg.de/raetsch/suppl/qpalma" target="_blank">QPalma</a> - Optimal Spliced Alignments of Short Sequence Reads. Authors are Fabio De Bona, Stephan Ossowski, Korbinian Schneeberger, and Gunnar R&auml;tsch. A paper is <a href="http://www.fml.tuebingen.mpg.de/raetsch/suppl/qpalma/qpalma-final.pdf" target="_blank">available</a>.<br /> * <a href="http://biogibbs.stanford.edu/%7Ejiangh/rsat/" target="_blank">RSAT</a> - RSAT: RNA-Seq Analysis Tools. RNASAT is developed and maintained by Hui Jiang at Stanford University.<br /> * <a href="http://tophat.cbcb.umd.edu/" target="_blank">TopHat</a> - TopHat is a fast splice junction mapper for RNA-Seq reads. It aligns RNA-Seq reads to mammalian-sized genomes using the ultra high-throughput short read aligner Bowtie, and then analyzes the mapping results to identify splice junctions between exons. TopHat is a collaborative effort between the University of Maryland and the University of California, Berkeley</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/35621/bbtools-for-bioinformatician</guid>
	<pubDate>Thu, 15 Feb 2018 16:45:52 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/35621/bbtools-for-bioinformatician</link>
	<title><![CDATA[BBTools for bioinformatician !]]></title>
	<description><![CDATA[<p><span></span><br /><strong>BBMap.sh</strong><br /><br /></p><ul>
<li><strong>Mapping Nanopore reads</strong></li>
</ul><p><br /><span>BBMap.sh has a length cap of 6kbp. Reads longer than this will be broken into 6kbp pieces and mapped independently.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ mapPacBio.sh -Xmx20g k=7 in=reads.fastq ref=reference.fa maxlen=1000 minlen=200 idtag ow int=f qin=33 out=mapped1.sam minratio=0.15 ignorequality slow ordered maxindel1=40 maxindel2=400</pre></div><p><br /><span>The "maxlen" flag shreds them to a max length of 1000; you can set that up to 6000. But I found 1000 gave a higher mapping rate.&nbsp;&nbsp;</span><br /><br /></p><ul>
<li><strong>Using Paired-end and single-end reads at the same time</strong></li>
</ul><p><br /><span>BBMap itself can only run single-ended or paired-ended in a single run, but it has a wrapper that can accomplish it, like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbwrap.sh in1=read1.fq,singletons.fq in2=read2.fq,null out=mapped.sam append</pre></div><p><span>This will write all the reads to the same output file but only print the headers once. I have not tried that for bam output, only sam output</span><br /><br /><span>Note about alignment stats: For paired reads, you can find the total percent mapped by adding the read 1 percent (where it says "mapped: N%") and read 2 percent, then dividing by 2. The different columns tell you the count/percent of each event. Considering the cigar strings from alignment, "Match Rate" is the number of symbols indicating a reference match (=) and error rate is the number indicating substitution, insertion, or deletion (X, I, D).</span><br /><br /></p><ul>
<li><strong>Exact matches when mapping small reads (e.g. miRNA)</strong></li>
</ul><p><br /><span>When mapping small RNA's with BBMap use the following flags to report only perfect matches.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">ambig=all vslow perfectmode maxsites=1000</pre></div><p><span>It should be very fast in that mode (despite the vslow flag). Vslow mainly removes masking of low-complexity repetitive kmers, which is not usually a problem but can be with extremely short sequences like microRNAs.</span></p><ul>
<li><strong>Important note about BBMap alignments</strong></li>
</ul><p><br /><span>BBMap is always nondeterministic when run in paired-end mode with multiple threads, because the insert-size average is calculated on a per-thread basis, which affects mapping; and which reads are assigned to which thread is nondeterministic. The only way to avoid that would be to restrict it to a single thread (threads=1), or map the reads as single-ended and then fix pairing afterward:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">bbmap.sh in=reads.fq outu=unmapped.fq int=f
repair.sh in=unmapped.fq out=paired.fq fint outs=singletons.fq</pre></div><p><span>In this case you'd want to only keep the paired output.&nbsp;</span><br /><br /><span>BBSplit is based on BBMap, so it is also nondeterministic in paired mode with multiple threads. BBDuk and Seal (which can be used similarly to BBSplit) are always deterministic.&nbsp;</span><br /><br /><span>--------------------------------------------------------</span><br /><br /><strong>Reformat.sh</strong></p><ul>
<li><strong>Count k-mers/find unknown primers</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fq out=trimmed.fq ftr=19</pre></div><p><span>This will trim all but the first 20 bases (all bases after position 19, zero-based).</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ kmercountexact.sh in=trimmed.fq out=counts.txt fastadump=f mincount=10 k=20 rcomp=f</pre></div><p><span>This will generate a file containing the counts of all 20-mers that occurred at least 10 times, in a 2-column format that is easy to sort in Excel.&nbsp;</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">ACCGTTACCGTTACCGTTAC	100
AAATTTTTTTCCCCCCCCCC	85</pre></div><p><span>...etc. If the primers are 20bp long, they should be pretty obvious.&nbsp;&nbsp;</span></p><ul>
<li><strong>Convert SAM format from 1.4 to 1.3 (required for many programs)</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.sam out=out.sam sam=1.3</pre></div><ul>
<li><strong>Removing N basecalls</strong></li>
</ul><p><br /><span>You can use BBDuk or Reformat with "qtrim=rl trimq=1". That will only trim trailing and leading bases with Q-score below 1, which means Q0, which means N (in either fasta or fastq format). The BBMap package automatically changes q-scores of Ns that are above 0 to 0 and called bases with q-scores below 2 to 2, since occasionally some Illumina software versions produces odd things like a handful of Q0 called bases or Ns with Q&gt;0, neither of which make any sense in the Phred scale.</span></p><ul>
<li><strong>Sampling reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fq out=sampled.fq sample=3000</pre></div><div><div>Code:</div><pre dir="ltr">To sample 10% of the reads:
reformat.sh in1=reads1.fq in2=reads2.fq out1=sampled1.fq out2=sampled2.fq samplerate=0.1

or more concisely:
reformat.sh in=reads#.fq out=sampled#.fq samplerate=0.1

and for exact sampling:
reformat.sh in=reads#.fq out=sampled#.fq samplereadstarget=100k</pre></div><ul>
<li><strong>Changing fasta headers</strong></li>
</ul><p><br /><span>Remove anything after the first space in fasta header.&nbsp;</span><br /><br /></p><div><div>Code:</div><pre dir="ltr"> reformat.sh in=sequences.fasta out=renamed.fasta trd</pre></div><p><span>"trd" stands for "trim read description" and will truncate everything after the first whitespace.</span></p><ul>
<li><strong>Extract reads from a sam file</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.sam out=reads.fastq</pre></div><ul>
<li><strong>Verify pairing and optionally de-interleave the reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fastq verifypairing</pre></div><ul>
<li><strong>Verify pairing if the reads are in separate files</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in1=r1.fq in2=r2.fq vpair</pre></div><p><span>If that completes successfully and says the reads were correctly paired, then you can simply de-interleave reads into two files like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fastq out1=r1.fastq out2=r2.fastq</pre></div><ul>
<li><strong>Base quality histograms</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fq qchist=qchist.txt</pre></div><p><span>That stands for "quality count histogram".&nbsp;</span></p><ul>
<li><strong>Filter SAM/BAM file by read length</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=x.sam out=y.sam minlength=50 maxlength=200</pre></div><ul>
<li><strong>Filter SAM/BAM file to detect/filter spliced reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=mapped.bam out=filtered.bam maxdellen=50</pre></div><p><span>You can set "maxdellen" to whatever length deletion event you consider the minimum to signify splicing, which depends on the organism.</span><br /><span>-------------------------------------------------------------</span><br /><strong>Repair.sh</strong></p><ul>
<li><strong>"Re-pair" out-of-order reads from paired-end data files</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ repair.sh in1=r1.fq.gz in2=r2.fq.gz out1=fixed1.fq.gz out2=fixed2.fq.gz outsingle=singletons.fq.gz</pre></div><p><span>--------------------------------------------------------------</span><br /><strong>BBMerge.sh</strong><br /><br /><span>BBMerge now has a new flag - "outa" or "outadapter". This allows you to automatically detect the adapter sequence of reads with short insert sizes, in case you don't know what adapters were used. It works like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbmerge.sh in=reads.fq outa=adapters.fa reads=1m</pre></div><p><span>Of course, it will only work for paired reads! The output fasta file will look like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">&gt;Read1_adapter
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
&gt;Read2_adapter
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG</pre></div><p><span>If you have multiplexed things with different barcodes in the adapters, the part with the barcode will show up as Ns, like this:</span><br /><br /><span>GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG&nbsp;&nbsp;</span><br /><br /><span>Note: For BBMerge with micro-RNA, you need to add the flag&nbsp;</span><strong>mininsert=17</strong><span>. The default is 35, which is too long for micro-RNA libraries.&nbsp;</span></p><ul>
<li><strong>Identifying adapters</strong></li>
</ul><p><span>If you have paired reads, and enough of the reads have inserts shorter than read length, you can identify adapter sequences with BBMerge, like this (they will be printed to adapters.fa):</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbmerge.sh in1=r1.fq in2=r2.fq outa=adapters.fa</pre></div><p><br /><span>-----------------------------------------------------------------</span><br /><br /><strong>BBDuk.sh</strong><br /><br /><span>Note: BBDuk is strictly deterministic on a per-read basis, however it does by default reorder the reads when run multithreaded. You can add the flag "ordered" to keep output reads in the same order as input reads</span></p><ul>
<li><strong>Finding reads with a specific sequence at the beginning of read</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ bbduk.sh -Xmx1g in=reads.fq outm=matched.fq outu=unmatched.fq restrictleft=25 k=25 literal=AAAAACCCCCTTTTTGGGGGAAAAA</pre></div><p><span>In this case, all reads starting with "AAAAACCCCCTTTTTGGGGGAAAAA" will end up in "matched.fq" and all other reads will end up in "unmatched.fq". Specifically, the command means "look for 25-mers in the leftmost 25 bp of the read", which will require an exact prefix match, though you can relax that if you want.</span><br /><br /><span>So you could bin all the reads with your known sequence, then look at the remaining reads to see what they have in common. You can do the same thing with the tail of the read using "restrictright" instead, though you can't use both restrictions at the same time.&nbsp;&nbsp;</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbduk.sh in=reads.fq outm=matched.fq literal=NNNNNNCCCCGGGGGTTTTTAAAAA k=25 copyundefined</pre></div><p><span>With the "copyundefined" flag, a copy of each reference sequence will be made representing every valid combination of defined letter. So instead of increasing memory or time use by 6^75, it only increases them by 4^6 or 4096 which is completely reasonable, but it only allows substitutions at predefined locations. You can use the "copyundefined", "hdist", and "qhdist" flags together for a lot of flexibility - for example, hdist=2 qhdist=1 and 3 Ns in the reference would allow a hamming distance of 6 with much lower resource requirements than hdist=6. Just be sure to give BBDuk as much memory as possible.</span></p><ul>
<li><strong>Removing illumina adapters (if exact adapters not known)</strong></li>
</ul><p><br /><span>If you're not sure which adapters are used, you can add "ref=truseq.fa.gz,truseq_rna.fa.gz,nextera.fa.gz" and get them all (this will increase the amount of overtrimming, though it should still be negligible).&nbsp;</span></p><ul>
<li><strong>Removing illumina control sequences/phiX reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">bbduk.sh in=trimmed.fq.gz out=filtered.fq.gz k=31 ref=artifacts,phix ordered cardinality</pre></div><ul>
<li><strong>Identify certain reads that contain a specific sequence</strong></li>
</ul><div><div>Code:</div><pre dir="ltr">$ bbduk.sh in=reads.fq out=unmatched.fq outm=matched.fq literal=ACGTACGTACGTACGTAC k=18 mm=f hdist=2</pre></div><p><span>Make sure "k" is set to the exact length of the sequence. "hdist" controls the number of substitutions allowed. "outm" gets the reads that match. By default this also looks for the reverse-complement; you can disable that with "rcomp=f".&nbsp;&nbsp;</span></p><ul>
<li><strong>Extract sequences that share kmers with your sequences with BBDuk</strong></li>
</ul><div><div>Code:</div><pre dir="ltr">$ bbduk.sh in=a.fa ref=b.fa out=c.fa mkf=1 mm=f k=31</pre></div><p><span>This will print to C all the sequences in A that share 100% of their 31-mers with sequences in B.&nbsp;</span><br /><br /></p><ul>
<li><strong>Extract sequences that contain N's with BBDuk</strong></li>
</ul><div><div>Code:</div><pre dir="ltr">bbduk.sh in=reads.fq out=readsWithoutNs.fq outm=readsWithNs.fq maxns=0</pre></div><p><span>If you have, say, 100bp reads and only want to separate reads containing all 100 Ns, change that to "maxns=99".</span><br /><br /><strong>General notes for BBDuk.sh</strong><span>&nbsp;</span><br /><br /><span>BBDuk can operate in one of 4 kmer-matching modes:</span><br /><span>Right-trimming (ktrim=r), left-trimming (ktrim=l), masking (ktrim=n), and filtering (default). But it can only do one at a time because all kmers are stored in a single table. It can still do non-kmer-based operations such as quality trimming at the same time.</span><br /><br /><span>BBDuk2 can do all 4 kmer operations at once and is designed for integration into automated pipelines where you do contaminant removal and adapter-trimming in a single pass to minimize filesystem I/O. Personally, I never use BBDuk2 from the command line. Both have identical capabilities and functionality otherwise, but the syntax is different.</span><br /><br /><span>------------------------------------------------------------------</span><br /><br /><strong>Randomreads.sh</strong></p><ul>
<li><strong>Generate random reads in various formats</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ randomreads.sh ref=genome.fasta out=reads.fq len=100 reads=10000</pre></div><p><span>You can specify paired reads, an insert size distribution, read lengths (or length ranges), and so forth. But because I developed it to benchmark mapping algorithms, it is specifically designed to give excellent control over mutations. You can specify the number of snps, insertions, deletions, and Ns per read, either exactly or probabilistically; the lengths of these events is individually customizable, the quality values can alternately be set to allow errors to be generated on the basis of quality; there's a PacBio error model; and all of the reads are annotated with their genomic origin, so you will know the correct answer when mapping.</span><br /><br /><span>Bear in mind that 50% of the reads are going to be generated from the plus strand and 50% from the minus strand. So, either a read will match the reference perfectly, OR its reverse-complement will match perfectly.</span><br /><br /><span>You can generate the same set of reads with and without SNPs by fixing the seed to a positive number, like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ randomreads.sh maxsnps=0 adderrors=false out=perfect.fastq reads=1000 minlength=18 maxlength=55 seed=5

$ randomreads.sh maxsnps=2 snprate=1 adderrors=false out=2snps.fastq reads=1000 minlength=18 maxlength=55 seed=5</pre></div><p><span>[As of BBmap v. 36.59] rendomreads.sh gains the ability to simulate metagenomes.&nbsp;</span><br /><br /><span>coverage=X will automatically set "reads" to a level that will give X average coverage (decimal point is allowed).</span><br /><br /><span>metagenome will assign each scaffold a random exponential variable, which decides the probability that a read be generated from that scaffold. So, if you concatenate together 20 bacterial genomes, you can run randomreads and get a metagenomic-like distribution. It could also be used for RNA-seq when using a transcriptome reference.</span><br /><br /><span>The coverage is decided on a per-reference-sequence level, so if a bacterial assembly has more than one contig, you may want to glue them together first with fuse.sh before concatenating them with the other references.&nbsp;</span><br /><br /></p><ul>
<li><strong>Simulate a jump library</strong></li>
</ul><p><br /><span>You can simulate a 4000bp jump library from your existing data like this.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ cat assembly1.fa assembly2.fa &gt; combined.fa
$ bbmap.sh ref=combined.fa
$ randomreads.sh reads=1000000 length=100 paired interleaved mininsert=3500 maxinsert=4500 bell perfect=1 q=35 out=jump.fq.gz</pre></div><p><span>--------------------------------------------------------------</span><br /><strong>Shred.sh</strong><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ shred.sh in=ref.fasta out=reads.fastq length=200</pre></div><p><span>The difference is that RandomReads will make reads in a random order from random locations, ensuring flat coverage on average, but it won't ensure 100% coverage unless you generate many fold depth. Shred, on the other hand, gives you exactly 1x depth and exactly 100% coverage (and is not capable of modelling errors). So, the use-cases are different.&nbsp;</span><br /><span>---------------------------------------------------------------</span><br /><strong>Demuxbyname.sh</strong></p><ul>
<li><strong>Demultiplex fastq files when the tag is present in the fastq read header (illumina)</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ demuxbyname.sh in=r#.fq out=out_%_#.fq prefixmode=f names=GGACTCCT+GCGATCTA,TAAGGCGA+TCTACTCT,...
outu=filename</pre></div><p><span>"Names" can also be a text file with one barcode per line (in exactly the format found in the read header). You do have to include all of the expected barcodes, though.</span><br /><br /><span>In the output filename, the "%" symbol gets replaced by the barcode; in both the input and output names, the "#" symbol gets replaced by 1 or 2 for read 1 or read 2. It's optional, though; you can leave it out for interleaved input/output, or specify in1=/in2=/out1=/out2= if you want custom naming.</span><br /><br /><span>----------------------------------------------------------------</span><br /><br /><strong>Readlength.sh</strong></p><ul>
<li><strong>Plotting the length distribution of reads</strong></li>
</ul><div><div>Code:</div><pre dir="ltr">$ readlength.sh in=file out=histogram.txt bin=10 max=80000</pre></div><p><span>That will plot the result in bins of size 10, with everything above 80k placed in the same bin. The defaults are set for relatively short sequences so if they are many megabases long you may need to add the flag "-Xmx8g" and increase "max=" to something much higher.</span><br /><br /><span>Alternatively, if these are assemblies and you're interested in continuity information (L50, N50, etc), you can run stats on each or statswrapper on all of them:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">stats.sh in=file</pre></div><p><span>or</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">statswrapper.sh in=file,file,file,file&hellip;</pre></div><p><span>----------------------------------------------------------------</span><br /><strong>Filterbyname.sh</strong><br /><br /><span>By default, "filterbyname" discards reads with names in your name list, and keeps the rest. To include them and discard the others, do this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ filterbyname.sh in=003.fastq out=filter003.fq names=names003.txt include=t</pre></div><p><span>----------------------------------------------------------------</span><br /><strong>getreads.sh</strong><br /><br /><span>If you only know the number(s) of the fasta/fastq record(s) in a file (records start at 0) then you can use the following command to extract those reads in a new file.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ getreads.sh in= id=&lt;number,number,number...&gt; out=</pre></div><p><span>The first read (or pair) has ID 0, the second read (or pair) has ID 1, etc.</span><br /><br /><span>Parameters:</span><br /><span>in= Specify the input file, or stdin.</span><br /><span>out= Specify the output file, or stdout.</span><br /><span>id= Comma delimited list of numbers or ranges, in any order.</span><br /><span>For example: id=5,93,17-31,8,0,12-13&nbsp;</span><br /><span>----------------------------------------------------------------</span><br /><strong>Splitsam.sh</strong></p><ul>
<li><strong>Splits a sam file into forward and reverse reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">splitsam.sh mapped.sam plus.sam minus.sam unmapped.sam
reformat.sh in=plus.sam out=plus.fq
reformat.sh in=minus.sam out=minus.fq rcomp</pre></div><p><span>----------------------------------------------------------------</span><br /><strong>BBSplit.sh</strong><br /><br /><span>BBSplit now has the ability to output paired reads in dual files using the # symbol. For example:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbsplit.sh ref=x.fa,y.fa in1=read1.fq in2=read2.fq basename=o%_#.fq</pre></div><p><span>will produce ox_1.fq, ox_2.fq, oy_1.fq, and oy_2.fq</span><br /><br /><span>You can use the # symbol for input also, like "in=read#.fq", and it will get expanded into 1 and 2.&nbsp;&nbsp;</span><br /><br /><strong>Added feature:&nbsp;</strong><span>One can specify a directory for the "ref=" argument. If anything in the list is a directory, it will use all fasta files in that directory. They need a fasta extension, like .fa or .fasta, but can be compressed with an additional .gz after that. Reason this is useful is to use BBSplit is to have it split input into one output file per reference file.</span><br /><br /><br /><strong>NOTE: 1</strong><span>&nbsp;By default BBSplit uses fairly strict mapping parameters; you can get the same sensitivity as BBMap by adding the flags "minid=0.76 maxindel=16k minhits=1". With those parameters it is extremely sensitive.</span><br /><br /><strong>NOTE: 2</strong><span>&nbsp;BBSplit has different ambiguity settings for dealing with reads that map to multiple genomes. In any case, if the alignment score is higher to one genome than another, it will be associated with that genome only (this considers the combined scores of read pairs - pairs are always kept together). But when a read or pair has two identically-scoring mapping locations, on different genomes, the behavior is controlled by the "ambig2" flag - "ambig2=toss" will discard the read, "all" will send it to all output files, and "split" will send it to a separate file for ambiguously-mapped reads (one per genome to which it maps).</span><br /><br /><strong>NOTE: 3</strong><span>&nbsp;Zero-count lines are suppressed by default, but they should be printed if you include the flag "nzo=f" (nonzeroonly=false).&nbsp;</span><br /><br /><strong>NOTE: 4</strong><span>&nbsp;BBSplit needs multiple reference files as input; one per organism, or one for target and another for everything else. It only outputs one file per reference file.</span><br /><br /><span>Seal.sh, on the other hand, which is similar, can use a single concatenated file, as it (by default) will output one file per reference sequence within a concatenated set of references.&nbsp;</span><br /><span>--------------------------------------------------------------</span><br /><strong>Pileup.sh</strong></p><ul>
<li><strong>To generate transcript coverage stats</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ pileup.sh in=mapped.sam normcov=normcoverage.txt normb=20 stats=stats.txt</pre></div><p><span>That will generate coverage per transcript, with 20 lines per transcript, each line showing the coverage for that fraction of the transcript. "stats" will contain other information like the fraction of bases in each transcript that was covered.&nbsp;</span></p><ul>
<li><strong>To calculate physical coverage stats (region covered by paired-end reads)&nbsp;</strong></li>
</ul><p><span>BBMap has a "physcov" flag that allows it to report physical rather than sequenced coverage. It can be used directly in BBMap, or with pileup, if you already have a sam file. For example:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ pileup.sh in=mapped.sam covstats=coverage.txt</pre></div><ul>
<li><strong>Calculating coverage of the genome</strong></li>
</ul><p><br /><span>Program will take sam or bam, sorted or unsorted.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ pileup.sh in=mapped.sam out=stats.txt hist=histogram.txt</pre></div><p><span>stats.txt will contain the average depth and percent covered of each reference sequence; the histogram will contain the exact number of bases with a each coverage level. You can also get per-base coverage or binned coverage if you want to plot the coverage. It also generates median and standard deviation, and so forth.</span><br /><br /><span>It's also possible to generate coverage directly from BBMap, without an intermediate sam file, like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbmap.sh in=reads.fq ref=reference.fasta nodisk covstats=stats.txt covhist=histogram.txt</pre></div><p><span>We use this a lot in situations where all you care about is coverage distributions, which is somewhat common in metagenome assemblies. It also supports most of the flags that pileup.sh supports, though the syntax is slightly different to prevent collisions. In each case you can see all the possible flags by running the shellscript with no arguments.</span></p><ul>
<li><strong>To bin aligned reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ pileup.sh in=mapped.sam out=stats.txt bincov=coverage.txt binsize=1000</pre></div><p><span>That will give coverage within each bin. For read density regardless of read length, add the "startcov=t" flag.&nbsp;&nbsp;</span><br /><br /><span>--------------------------------------------------------------</span><br /><strong>Dedupe.sh</strong><br /><br /><span>Dedupe ensures that there is at most one copy of any input sequence, optionally allowing contaminants (substrings) to be removed, and a variable hamming or edit distance to be specified. Usage:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ dedupe.sh in=assembly1.fa,assembly2.fa out=merged.fa</pre></div><p><span>That will absorb exact duplicates and containments. You can use "hdist" and "edist" flags to allow mismatches, or get a complete list of flags by running the shellscript with no arguments.&nbsp;&nbsp;</span><br /><br /><span>Dedupe&nbsp;</span><span style="text-decoration: underline;">will merge assemblies</span><span>, but it&nbsp;</span><span style="text-decoration: underline;">will not produce consensus sequences or join overlapping reads</span><span>; it only removes sequences that are fully contained within other sequences (allowing the specified number of mismatches or edits).</span><br /><br /><span>Dedupe can remove duplicate reads from multiple files simultaneously, if they are comma-delimited (e.g. in=file1.fastq,file2.fastq,file3.fastq). And if you set the flag "uniqueonly=t" then ALL copies of duplicate reads will be removed, as opposed to the default behavior of leaving one copy of duplicate reads.</span><br /><br /><span>However, it does not care which file a read came from; in other words, it can't remove only reads that are duplicates across multiple files but leave the ones that are duplicates within a file. That can still be accomplished, though, like this:</span><br /><br /><span>1) Run dedupe on each sample individually, so now there are at most 1 copy of a read per sample.</span><br /><span>2) Run dedupe again on all of the samples together, with "uniqueonly=t". The only remaining duplicate reads will be the ones duplicated between samples, so that's all that will be removed.&nbsp;&nbsp;</span><br /><br /><span>--------------------------------------------------------------</span></p><ul>
<li><strong>Generate ROC curves from any aligner</strong></li>
</ul><p><br /><strong>[*]index the reference<br /><br /></strong></p><div><div>Code:</div><pre dir="ltr">$ bbmap.sh ref=reference.fasta</pre></div><p><br /><strong>[*]Generate random reads</strong><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ randomreads.sh reads=100000 length=100 out=synth.fastq maxq=35 midq=25 minq=15</pre></div><p><strong>[*]Map to produce a sam file</strong><br /><br /><span>...substitute this command with the appropriate one from your aligner of choice</span></p><div><div>Code:</div><pre dir="ltr">$ bbmap.sh in=synth.fq out=mapped.sam</pre></div><p><strong>[*]Generate ROC curve</strong><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ samtoroc.sh in=mapped.sam reads=100000</pre></div><p><span>--------------------------------------------------------------</span></p><ul>
<li><strong>Calculate heterozygous rate for sequence data</strong></li>
</ul><p><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ kmercountexact.sh in=reads.fq khist=histogram.txt peaks=peaks.txt</pre></div><p><span>You can examine the histogram manually, or use the "peaks" file which tells you the number of unique kmers in each peak on the histogram. For a diploid, the first peak will be the het peak, the second will be the homozygous peak, and the rest will be repeat peaks. The peak caller is not perfect, though, so particularly with noisy data I would only rely on it for the first two peaks, and try to quantify the higher-order peaks manually if you need to (which you generally don't).</span><br /><br /><span>-----------------------------------------------------------------</span></p><ul>
<li><strong>Compare mapped reads between two files</strong></li>
</ul><p><br /><span>To see how many mapped reads (can be mapped concordant or discordant, doesn't matter) are shared between the two alignment files and how many mapped reads are unique to one file or the other.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=file1.sam out=mapped1.sam mappedonly
$ reformat.sh in=file2.sam out=mapped2.sam mappedonly</pre></div><p><span>That gets you the mapped reads only. Then:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ filterbyname.sh in=mapped1.sam names=mapped2.sam out=shared.sam include=t</pre></div><p><span>...which gets you the set intersection;</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ filterbyname.sh in=mapped1.sam names=mapped2.sam out=only1.sam include=f
$ filterbyname.sh in=mapped2.sam names=mapped1.sam out=only2.sam include=f</pre></div><p><span>...which get you the set subtractions.&nbsp;&nbsp;</span><br /><br /><span>--------------------------------------------------------------</span><br /><br /><strong>BBrename.sh</strong></p><div><div>Code:</div><pre dir="ltr">$ bbrename.sh in=old.fasta out=new.fasta</pre></div><p><span>That will rename the reads as 1, 2, 3, 4, ... 222.</span><br /><br /><span>You can also give a custom prefix if you want. The input has to be text format, not .doc.&nbsp;&nbsp;</span><br /><br /><span>---------------------------------------------------------------------</span><br /><br /><strong>BBfakereads.sh</strong></p><ul>
<li><strong>Generating &ldquo;fake&rdquo; paired end reads from a single end read file</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ bfakereads.sh in=reads.fastq out1=r1.fastq out2=r2.fastq length=100</pre></div><p><span>That will generate fake pairs from the input file, with whatever length you want (maximum of input read length). We use it in some cases for generating a fake LMP library for scaffolding from a set of contigs. Read 1 will be from the left end, and read 2 will be reverse-complemented and from the right end; both will retain the correct original qualities. And " /1" " /2" will be suffixed after the read name.&nbsp;&nbsp;</span><br /><br /><span>------------------------------------------------------------------</span><br /><strong>Randomreads.sh</strong></p><ul>
<li><strong>Generate random reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ randomreads.sh ref=genome.fasta out=reads.fq len=100 reads=10000</pre></div><p><span>"seed=-1" will use a random seed; any other value will use that specific number as the seed</span><br /><br /><span>You can specify paired reads, an insert size distribution, read lengths (or length ranges), and so forth. But because I developed it to benchmark mapping algorithms, it is specifically designed to give excellent control over mutations. You can specify the number of snps, insertions, deletions, and Ns per read, either exactly or probabilistically; the lengths of these events is individually customizable, the quality values can alternately be set to allow errors to be generated on the basis of quality; there's a PacBio error model; and all of the reads are annotated with their genomic origin, so you will know the correct answer when mapping.</span><br /><br /><span>--------------------------------------------------------------------</span></p><ul>
<li><strong>Generate saturation curves to assess sequencing depth</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ bbcountunique.sh in=reads.fq out=histogram.txt</pre></div><p><span>It works by pulling kmers from each input read, and testing whether it has been seen before, then storing it in a table.</span><br /><br /><span>The bottom line, "first", tracks whether the first kmer of the read has been seen before (independent of whether it is read 1 or read 2).</span><br /><br /><span>The top line, "pair", indicates whether a combined kmer from both read 1 and read 2 has been seen before. The other lines are generally safe to ignore but they track other things, like read1- or read2-specific data, and random kmers versus the first kmer.</span><br /><br /><span>It plots a point every X reads (configurable, default 25000).</span><br /><br /><span>In noncumulative mode (default), a point indicates "for the last X reads, this percentage had never been seen before". In this mode, once the line hits zero, sequencing more is not useful.</span><br /><br /><span>In cumulative mode, a point indicates "for all reads, this percentage had never been seen before", but still only one point is plotted per X reads.</span><br /><br /><span>-----------------------------------------------------------------</span><br /><strong>CalcTrueQuality.sh</strong><br /><br /><a href="http://seqanswers.com/forums/showthread.php?p=170904" target="_blank">http://seqanswers.com/forums/showthread.php?p=170904</a><br /><br /><span>In light of the quality-score issues with the NextSeq platform, and the possibility of future Illumina platforms (HiSeq 3000 and 4000) also using quantized quality scores, I developed it for recalibrating the scores to ensure accuracy and restore the full range of values.</span><br /><br /><span>-----------------------------------------------------------------</span><br /><br /><strong>BBMapskimmer.sh</strong><br /><br /><span>BBMap is designed to find the best mapping, and heuristics will cause it to ignore mappings that are valid but substantially worse. Therefore, I made a different version of it, BBMapSkimmer, which is designed to find all of the mappings above a certain threshold. The shellscript is bbmapskimmer.sh and the usage is similar to bbmap.sh or mapPacBio.sh. For primers, which I assume will be short, you may wish to use a lower than default K of, say, 10 or 11, and add the "slow" flag.</span><br /><br /><span>--------------------------------------------------------------</span><br /><br /><strong>msa.sh and curprimers.sh</strong><br /><br /><span>Quoted from Brian's response directly.</span><br /><br /><span>I also wrote another pair of programs specifically for working with primer pairs, msa.sh and cutprimers.sh. msa.sh will forcibly align a primer sequence (or a set of primer sequences) against a set of reference sequences to find the single best matching location per reference sequence - in other words, if you have 3 primers and 100 ref sequences, it will output a sam file with exactly 100 alignments - one per ref sequence, using the primer sequence that matched best. Of course you can also just run it with 1 primer sequence.</span><br /><br /><span>So you run msa twice - once for the left primer, and once for the right primer - and generate 2 sam files. Then you feed those into cutprimers.sh, which will create a new fasta file containing the sequence between the primers, for each reference sequence. We used these programs to synthetically cut V4 out of full-length 16S sequences.</span><br /><br /><span>I should say, though, that the primer sites identified are based on the normal BBMap scoring, which is not necessarily the same as where the primers would bind naturally, though with highly conserved regions there should be no difference.</span><br /><br /><span>------------------------------------------------------</span><br /><strong>testformat.sh</strong><br /><br /><strong>Identify type of Q-score encoding in sequence files</strong><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ testformat.sh in=seq.fq.gz
sanger    fastq    gz    interleaved    150bp</pre></div><p><span>--------------------------------------------------</span><br /><strong>kcompress.sh</strong><br /><br /><span>Newest member of BBTools. Identify constituent k-mers.&nbsp;</span><br /><a href="http://seqanswers.com/forums/showthread.php?t=63258" target="_blank">http://seqanswers.com/forums/showthread.php?t=63258</a><br /><br /><span>----------------------------------------------------</span><br /><strong>commonkmers.sh</strong><br /><br /><span>Find all k-mers for a given sequence.</span></p><div><div>Code:</div><pre dir="ltr">$ commonkmers.sh in=reads.fq out=kmers.txt k=4 count=t display=999</pre></div><p><span>Will produce output that looks like</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">MISEQ05:239:000000000-A74HF:1:2110:14788:23085	ATGA=8	ATGC=6	GTCA=6	AAAT=5	AAGC=5	AATG=5	AGCA=5	ATAA=5	ATTA=5	CAAA=5	CATA=5	CATC=5	CTGC=5	AACC=4	AACG=4	AAGA=4	ACAT=4	ACCA=4	AGAA=4	ATCA=4	ATGG=4	CAAG=4	CCAA=4	CCTC=4	CTCA=4	CTGA=4	CTTC=4	GAGC=4	GGTA=4	GTAA=4	GTTA=4	AAAA=3	AAAC=3	AAGT=3	ACCG=3	ACGG=3	ACTG=3	AGAT=3	AGCT=3	AGGA=3	AGTA=3	AGTC=3	CAGC=3	CATG=3	CGAG=3	CGGA=3	CGTC=3	CTAA=3	CTCC=3	CTTA=3	GAAA=3	GACA=3	GACC=3	GAGA=3	GCAA=3	GGAC=3	TCAA=3	TGCA=3	AAAG=2	AACA=2	AATA=2	AATC=2	ACAA=2	ACCC=2	ACCT=2	ACGA=2	ACGC=2	AGAC=2	AGCG=2	AGGC=2	CAAC=2	CAGG=2	CCGC=2	GCCA=2	GCTA=2	GGAA=2	GGCA=2	TAAA=2	TAGA=2	TCCA=2	TGAA=2	AAGG=1	AATT=1	ACGT=1	AGAG=1	AGCC=1	AGGG=1	ATAC=1	ATAG=1	ATTG=1	CACA=1	CACG=1	CAGA=1	CCAC=1	CCCA=1	CCGA=1	CCTA=1	CGAC=1	CGCA=1	CGCC=1	CGCG=1	CGTA=1	CTAC=1	GAAC=1	GCGA=1	GCGC=1	GTAC=1	GTGA=1	TTAA=1</pre></div><p><span>-----------------------------------------------------</span><br /><strong>Mutate.sh</strong><br /><br /><span>Simulate multiple mutants from a known reference (e.g.&nbsp;</span><em>E. coli</em><span>).</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ mutate.sh in=e_coli.fasta out=mutant.fasta id=99 
$ randomreads.sh ref=mutant.fasta out=reads.fq.gz reads=5m length=150 paired adderrors</pre></div><p><span>That will create a mutant version of E.coli with 99% identity to the original, and then generate 5 million simulated read pairs from the new genome. You can repeat this multiple times; each mutant will be different.</span><br /><br /><span>------------------------------------</span><br /><br /><strong>Partition.sh</strong><br /><br /><span>One can partition a large dataset with partition.sh into smaller subsets (example below splits data into 8 chunks).</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">partition.sh in=r1.fq in2=r2.fq out=r1_part%.fq out2=r2_part%.fq ways=8</pre></div><p><span>-----------------------------------</span><br /><strong>clumpify.sh</strong><br /><br /><span>If you are concerned about file size and want the files to be as small as possible, give Clumpify a try. It can reduce filesize by around 30% losslessly by reordering the reads. I've found that this also typically accelerates subsequent analysis pipelines by a similar factor (up to 30%). Usage:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">clumpify.sh in=reads.fastq.gz out=clumped.fastq.gz</pre></div><div><div>Code:</div><pre dir="ltr">clumpify.sh in1=reads_R1.fastq.gz in2=reads_R2.fastq.gz out1=clumped_R1.fastq.gz out2=clumped_R2.fastq.gz</pre></div><ul>
<li><strong>Clumpify.sh can now mark/remove sequence duplicates (optical/PCR/otherwise) from NGS data</strong></li>
</ul><p><br /><span>This does NOT require alignments so it should prove more useful compared to Picard MarkDuplicates. Relevant options for clumpify.sh command are listed below.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">dedupe=f optical=f (default)
Nothing happens with regards to duplicates.

dedupe=t optical=f
All duplicates are detected, whether optical or not.  All copies except one are removed for each duplicate.

dedupe=f optical=t
Nothing happens.

dedupe=t optical=t

Only optical duplicates (those with an X or Y coordinate within dist) are detected.  All copies except one are removed for each duplicate.
The allduplicates flag makes all copies of duplicates removed, rather than leaving a single copy.  But like optical, it has no effect unless dedupe=t.

Note: If you set "dupedist" to anything greater than 0, "optical" gets enabled automatically.</pre></div><p><span>-------------------------------------</span><br /><strong>fuse.sh</strong><br /><br /><span>Fuse will automatically reverse-complement read 2. Pad (N) amount can be adjusted as necessary. This will for example create a full size amplicon that can be used for alignments.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">fuse.sh in1=r1.fq in2=r2.fq pad=130 out=fused.fq fusepairs</pre></div>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/23149/raphael-lab</guid>
  <pubDate>Sat, 04 Jul 2015 19:05:29 -0500</pubDate>
  <link></link>
  <title><![CDATA[Raphael Lab]]></title>
  <description><![CDATA[
<p>Raphael Lab research is focused on Bioinformatics and Computational Biology.</p>

<p>Current research interests include next-generation DNA sequencing, structural variation, genome rearrangements in cancer and evolution, and network analysis of somatic mutations in cancer. Earlier research included topics in comparative genomics, multiple sequence alignment, and motif finding.</p>

<p>More athttp://compbio.cs.brown.edu/</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/23633/biorg</guid>
  <pubDate>Tue, 04 Aug 2015 20:52:52 -0500</pubDate>
  <link></link>
  <title><![CDATA[BioRG]]></title>
  <description><![CDATA[
<p>This research group works on problems from the fields of Bioinformatics, Biotechnology, Data Mining, and Information Retrieval. The group's research projects includes Comparative Genomics of Bacterial genomes, Metagenomics, Genomic databases, Pattern Discovery in sequences and structures, micro-array data analysis, prediction of regulatory elements, primer design, probe design, phylogenetic analysis, medical image processing, image analysis, data integration, data mining, information retrieval, knowledge discovery in electronic medical records, and more. </p>

<p>More at http://biorg.cis.fiu.edu/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43828/understanding-hifi-reads</guid>
	<pubDate>Thu, 24 Mar 2022 19:48:11 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43828/understanding-hifi-reads</link>
	<title><![CDATA[Understanding HiFi Reads !]]></title>
	<description><![CDATA[<p><span>While little public data is available for either of the new synthetic long read approaches, Illumina showed an example comparison earlier this year at the&nbsp;</span><a href="https://www.festivalofgenomics.com/rami-mehio" target="_blank">Festival of Genomics &amp; Biodata conference</a><span>&nbsp;(FoG 2022). In the IGV screenshot presented (below), synthetic Infinity reads &ndash; labeled &ldquo;Longas&rdquo; &ndash; are at the top, followed by standard Illumina short reads, and PacBio HiFi reads labeled &ldquo;CCS&rdquo; depicted at the bottom:</span></p><p>Address of the bookmark: <a href="http://pacb.com/blog/the-hifi-difference-true-long-reads-vs-synthetic-long-reads/" rel="nofollow">http://pacb.com/blog/the-hifi-difference-true-long-reads-vs-synthetic-long-reads/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38199/pacasus-correction-of-palindromes-in-long-reads-from-pacbio-and-nanopore</guid>
	<pubDate>Mon, 12 Nov 2018 05:26:48 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38199/pacasus-correction-of-palindromes-in-long-reads-from-pacbio-and-nanopore</link>
	<title><![CDATA[Pacasus: Correction of palindromes in long reads from PacBio and Nanopore]]></title>
	<description><![CDATA[<p><br>Tool for detecting and cleaning PacBio / Nanopore long reads after whole genome amplification. Check the poster from the Revolutionizing Next-Generation Sequencing (2nd edition) conference in the source folder:&nbsp;<a href="https://github.com/swarris/Pacasus/blob/master/vib2017.pdf">https://github.com/swarris/Pacasus/blob/master/vib2017.pdf</a>.</p>
<p>The prepint version is found on&nbsp;<a href="http://www.biorxiv.org/content/early/2017/08/09/173872">http://www.biorxiv.org/content/early/2017/08/09/173872</a></p>
<p>It uses the pyPaSWAS framework for sequence alignment (<a href="https://github.com/swarris/pyPaSWAS">https://github.com/swarris/pyPaSWAS</a>)</p><p>Address of the bookmark: <a href="https://github.com/swarris/Pacasus" rel="nofollow">https://github.com/swarris/Pacasus</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41669/filtlong-quality-filtering-tool-for-long-reads</guid>
	<pubDate>Wed, 13 May 2020 10:23:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41669/filtlong-quality-filtering-tool-for-long-reads</link>
	<title><![CDATA[Filtlong: quality filtering tool for long reads]]></title>
	<description><![CDATA[<p>Filtlong is a tool for filtering long reads by quality. It can take a set of long reads and produce a smaller, better subset. It uses both read length (longer is better) and read identity (higher is better) when choosing which reads pass the filter.</p>
<p>Filtlong builds into a stand-alone executable:</p>
<pre><code>git clone https://github.com/rrwick/Filtlong.git
cd Filtlong
make -j
bin/filtlong -h
</code></pre><p>Address of the bookmark: <a href="https://github.com/rrwick/Filtlong" rel="nofollow">https://github.com/rrwick/Filtlong</a></p>]]></description>
	<dc:creator>Radha Agarkar</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/25284/rajiv-gandhi-centre-for-biotechnology-rgcb-invites-applications-for-the-following-three-faculty-scientist</guid>
  <pubDate>Tue, 24 Nov 2015 22:13:16 -0600</pubDate>
  <link></link>
  <title><![CDATA[Rajiv Gandhi Centre for Biotechnology (RGCB) invites applications for the following three faculty scientist]]></title>
  <description><![CDATA[
<p>Scientist Positions<br />Advt. No.RGCB Advt./SCI 2015/1<br /> <br />November 11, 2015</p>

<p>Rajiv Gandhi Centre for Biotechnology (RGCB) invites applications for the following three faculty scientist positions:</p>

<p>Scientist E-II or F in Bioinformatics &amp; Computational Biology</p>

<p>SCIENTIST E-II OR F IN COMPUTATIONAL BIOLOGY &amp; BIOINFORMATICS</p>

<p>Highly motivated and innovative individual who will pursue basic research, solve biological problems with emphasis on computational and quantitative experimental methods and build active bridges to translational research. The scientist will also provide computational biology support to ongoing research programs in disease biology, provide assistance to analyze complex data sets generated by RGCB scientists and collaborators inclusive of including high dimensional “omics” data and next generation sequencing data, such as whole genome, exome, RNA-seq and ChIP-seq as well as provide leadership for high quality training for junior scientists and regular teaching programs of the institute. Areas of research of interest to RGCB include but are not limited to computational, systems, or quantitative biology with applications to cell biology, developmental biology, metabolism, genomics, proteomics, biophysics, biological information systems, network pharmacology, drug design and cancer research. The scientist’s responsibilities include efforts for the integration of DNA variant annotation with statistical genetic analysis methods including linkage, imputation and association methods, adopting novel and innovative methodologies to analyze, integrate and interpret high dimensional data sets, provision of annotation to robust genetics and genomics findings using several data sources and methods, data management of exploratory clinical and R&amp;D studies in partnership with other lines of genetic data generated from internal and external studies, delivery and documentation of genomic information to support genetic studies, ensuring high-quality genetic and genomic data is incorporated into exploratory- clinical research programs, developing tools that make maximum use of multiple data sources to support annotation of DNA variation and contributes to systems biology initiatives within RGCB </p>

<p>More at http://rgcb.res.in/scientist-positions/</p>

<p>Application Form http://rgcb.res.in/wp-content/uploads/2015/11/APPLICATION-FORMAT-FOR-SCIENTISTS.docx</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26325/crossmap</guid>
	<pubDate>Mon, 08 Feb 2016 15:47:00 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26325/crossmap</link>
	<title><![CDATA[CrossMap]]></title>
	<description><![CDATA[<p>CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between <em>different assemblies</em> (such as Human <a href="http://www.ncbi.nlm.nih.gov/assembly/2928/">hg18 (NCBI36)</a> &lt;&gt; <a href="http://www.ncbi.nlm.nih.gov/assembly/2758/">hg19 (GRCh37)</a>, Mouse <a href="http://www.ncbi.nlm.nih.gov/assembly/165668/">mm9 (MGSCv37)</a> &lt;&gt; <a href="http://www.ncbi.nlm.nih.gov/assembly/327618/">mm10 (GRCm38)</a>).</p>
<p>It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.</p>
<p>CrossMap is designed to liftover genome coordinates between assemblies. It&rsquo;s <em>not</em> a program for aligning sequences to reference genome.</p>
<p>We <em>do not</em> recommend using CrossMap to convert genome coordinates between species.</p>
<p>More at http://crossmap.sourceforge.net/</p><p>Address of the bookmark: <a href="http://crossmap.sourceforge.net/" rel="nofollow">http://crossmap.sourceforge.net/</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26409/ucsc-genome-browser-and-blat-software</guid>
	<pubDate>Thu, 18 Feb 2016 03:18:57 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26409/ucsc-genome-browser-and-blat-software</link>
	<title><![CDATA[UCSC Genome Browser and Blat software !]]></title>
	<description><![CDATA[<p>This directory contains Genome Browser and Blat application binaries built for standalone <br>command-line use on various supported Linux and UNIX platforms. To determine which set of binaries <br>to download, type "uname -a" on the command line to display your machine type. In most cases the <br>usage statement for the application can be viewed by running the binary with no arguments. <br><br>The UCSC Genome Browser and Blat software are free for academic, nonprofit, and personal use. A <br>license is required for commercial download and installation of these binaries, with the exception <br>of items built from the following source code directories, which are freely available for all uses:<br><br>&nbsp;- kent/src/utils (includes big* tools)<br>&nbsp;- kent/src/lib<br>&nbsp;- kent/src/hg/autoSql<br>&nbsp;- kent/src/hg/autoXml<br><br>For information about commercial licensing of the Genome Browser software, see <br>http://genome.ucsc.edu/license/. The Blat and In-Silico PCR software may be commercially<br>licensed through Kent Informatics (http://www.kentinformatics.com).</p>
<p>More at http://hgdownload.cse.ucsc.edu/admin/exe/</p><p>Address of the bookmark: <a href="http://hgdownload.cse.ucsc.edu/admin/exe/" rel="nofollow">http://hgdownload.cse.ucsc.edu/admin/exe/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>