Though the specific implementation of the idea of the rectangle graph approach is already included into the current SPAdes distribution, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.

For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner. From de Bruijn Graphs to Rectangle Graphs for Genome Assembly, Lecture Notes in Bioinformatics 7534 (2012), pp. 249-261.

Address of the bookmark: http://bioinf.spbau.ru/en/rectangles

Genome Annotation and Functional Genomics

Bergman Lab is actively engaged in the development and application of computational methods to improve the annotation of functional biological features in genome sequences. Bergman Lab work focuses on improving annotation of non-protein-coding regions of the genome including conserved noncoding sequences (CNSs), cis-regulatory modules (CRMs), transcription factor binding sites (TFBSs), transposable elements (TEs) and noncoding RNA (ncRNA) genes. Current projects include improving the (i) annotation of TEs in the fly and yeast genomes, (ii) annotation of CRMs and TFBSs in the fly genome, and (iii) analysis of transposon knockout collections in flies. Research in this area is supported by the EC FP7 programme.

Genome and Molecular Evolution
Text and Data Mining

More @ http://bergmanlab.smith.man.ac.uk/

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

Nature Biotechnology spoke with Altschul and several other originators of computational biology software programs widely used today (Table 1). The conversations explored what makes certain software tools successful, the unique challenges of developing them for biological research and how the field of computational biology, as a whole, can move research agendas forward. What follows is an edited compilation of interviews.

Detail @ http://www.nature.com/nbt/journal/v31/n10/full/nbt.2721.html

News Source @ Nature

2013 Oct Advertisement from Indian Statistical Institute

Post: Network Analysis

No. of Positions: 01

Educational Qualifications:

Candidate should have passed BE/B.Tech Or Equivalent in Computer Science / Electrical Engineering / Electronics / Information Technology / Bioinformatics / Biotechnology with throughout first Class
Experience:

(details of experience required)
Pay Scale: INR Rs.16000-20000/-P.M.

Walk-In-Interview : 22 Oct 2013 at 10:30 AM

Download Official Notification:
http://www.isical.ac.in/JobApplicationFiles/MIU_0310201311433700.pdf

• nodes, which are labeled by sequences and ids
• edges, which connect two nodes via either of their respective ends
• paths, describe genomes, sequence alignments, and annotations (such as gene models and transcripts) as walks through nodes connected by edges

Address of the bookmark: https://github.com/vgteam/vg

Research Interest
Genomic Data Integration

Microarray Analysis

Gene and Protein Function Prediction

Detection and Analysis of Chromosomal Abnormalities and Functional Evolution

Integration of Computation and Experiments

Identification of Biological Networks and Pathways

Evaluation and Validation of Computational Predictions

Scalable Visualization-Based Data Analysis

More @ http://reducio.princeton.edu/cm/
PI page @ http://reducio.princeton.edu/cm/ogt

Details of the Positions and Pay Structure:

03 Posts for Assistant Professor in Molecular Synthesis for Drug Discovery and Development

Essential Qualifications and Requirements:

1. PhD in Synthetic Organic Chemistry/Medicinal Chemistry with research publications in high quality international journals and first class grade at the preceding degree from recognised University/Institute in India or abroad with consistently good academic record.
2. Three Yrs of Post-doctoral experience in relevant area.
3. Below 35 Yrs of age at the time of application

Desirable Experience: Candidates having strong research background in organic synthesis, total synthesis of structurally complex and medicinally important natural products/drugs related to cancer, neurodegenerative diseases (neurotropically active molecules for Alzheimer's, Parkinson’s, dementia etc) and infectious diseases such as malaria, TB etc. will be preferred.

Interested candidates may apply with:

1. Filled up Application Form (download from CBMR Website: http://www.cbmr.res.in) along with the Cover Letter, Curriculum Vitae including academic record (Bachelor degree onwards), awards, honours, list of Publications and reprints of 5 best publications.
2. Proposed research plan (max 3-4 pages).
3. Names and address (with valid e-mail and Phone number) of at least 3 academic referees.
4. Online Payment Receipt with transaction reference no. of Rs. 1000/- (USD 100 or equivalent foreign currency) on following details.
Account Number: 30054847814 Name: Director, Centre of Biomedical Research
Bank: STATE BANK OF INDIA, SGPGI Campus Branch, LUCKNOW

IFSC Code: SBIN0007789
MICR No: 22602034

Applications can be sent by registered/speed post or by e-mail to the following address:

The Director,
Centre of Biomedical Research (CBMR),
Sanjay Gandhi PGI Campus,
Raebareli Road, Lucknow-226014
e-mail: cbmr.admin@cbmr.res.in,
gp.pandey@cbmr.res.in

More Info:

http://www.cbmr.res.in/career/Advertisement%20for%20the%20post%20of%20Professors%20and%20Assistant%20Professors.pdf

We are seeking a highly motivated young PhD student with strong interest in high throughput data analysis.
Detailed descriptions of our recent research activities may be found here:
http://www.humanitas-research.org/condorelli-gianluigi-md-phd/

Position is available starting from October/November. A probationary period of one month will be required.

Please send a CV along with a cover letter stating the reasons for applying and contact details of one or more referees to Dr. Paolo Kunderfranco (paolo.kunderfranco@humanitasresearch.it).