<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29957?offset=680</link>
	<atom:link href="https://bioinformaticsonline.com/related/29957?offset=680" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/28286/nipgr-hires-research-associate-jrf-laboratory-assistant</guid>
  <pubDate>Mon, 04 Jul 2016 20:12:14 -0500</pubDate>
  <link></link>
  <title><![CDATA[NIPGR Hires Research Associate, JRF, Laboratory Assistant]]></title>
  <description><![CDATA[
<p>National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg - Delhi, Delhi <br />₹15,000 a month<br />National Institute of Plant Genome Research (NIPGR) invites applications to recruit on vacant posts of Research Associate (RA), Junior Research Fellow (JRF) and Laboratory Assistant. Applications against these Sarkari Naukri can be submitted on or before 16 July 2016. <br />NIPGR Vacancy 2016 Details <br />1. Research Associate (RA) <br />Qualification: Ph.D. degree (awarded) in Molecular Biology/Biotechnolgy/Biochemistry/Plant Science/ Life Sciences/Bioinformatics or related field with 03 years post-doctoral research experience or 02 research papers in the journals of International repute are eligible to apply. Experience in the area of functional genomics, proteomics, metabolomics, multiomics and system biology will be preferred. <br />Age Limit: As Per Rules <br />2. Junior Research Fellow (JRF) <br />Qualification: M.Sc. degree or equivalent in Biotechnolgy/Biochemistry/Plant Science or Botany/ Life Sciences/Bioinformatics/ Molecular Biology or any other related field. Experience in advanced multiomics, big data analysis, molecular and system biology techniques will be given preference. <br />Age Limit: As Per Rules <br />3. Laboratory Assistant <br />Qualification: B.Sc. degree with 05 years working experience in government R&amp;D Laboratory assisting in the field of molecular biology and genomis. <br />Pay Scale: Rs.15000/- Per Month <br />Age Limit: As Per Rules <br />How to Apply : Duly filled-in applications in prescribed application format along with copies of required documents should be reach to: Dr. Subhra Chakraborty, Staff Scientist-VII, National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, P.O. Box NO. 10531, New Delhi – 110067 . The Last Date to submit application is 16 July 2016</p>

<p>Source: http://www.nipgr.res.in/careers/vacancies_latest.php#<br />Form at http://www.nipgr.res.in/files/careers/format_RA_JRF_LA.doc</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/28546/ra-bioinformatics-at-national-bureau-of-fish-genetic-resources</guid>
  <pubDate>Mon, 25 Jul 2016 03:14:06 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at  National Bureau of Fish Genetic Resources]]></title>
  <description><![CDATA[
<p>F.No. 1(16)/2016-Admn. (DBT-BBSRC Project)<br />Research Associate /JRF Biotechnology Job vacancies in National Bureau of Fish Genetic Resources on contract basis</p>

<p>Research Associate /01 Post</p>

<p>Essential: Ph.D. in Bioinformatics or 03 years research experience after Post Graduation in Bioinformatics with at least one research paper in Science Citation Indexed (SCI) journals.</p>

<p>Desirable:  The candidate should have at least 1st Division during Graduation and Post Graduation.  Experience in assembly/ analysis/ annotation of genomic/transcriptomic data generated on next generation sequencing platforms and working knowledge on different genomic softwares.  Publications in Relevant Field.</p>

<p>Pay Scale : Rs. 36,000/- +20% HRA </p>

<p>Age: 40 years for male and 45 years for female candidates, as on the date of interview</p>

<p>Junior Research Fellow/ 01 </p>

<p>Essential: Master Degree in Biotechnology/Life Science with Specialization in Molecular Biology with NET qualification. </p>

<p>Desirable:  Research Experience in Molecular Biology. 1st Division during Graduation as well as Post Graduation. Publications in Relevant Field.</p>

<p>Pay Scale: Rs. 25,000/-+ 20% HRA for 1st and 2nd year and Rs. 28,000/-+ 20% HRA for 3rd year</p>

<p>Age: 35 years for male and 40 years for female candidates, as on the date of interview.<br />How to apply<br />A walk-in-interview will be held on 26.07.2016 at 10:00 hrs. at ICAR-National Bureau of Fish Genetic Resources, Lucknow.</p>

<p>More at http://www.nbfgr.res.in/Recruitments.aspx</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35635/ete-3-reconstruction-analysis-and-visualization-of-phylogenomic-data</guid>
	<pubDate>Mon, 19 Feb 2018 06:46:15 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35635/ete-3-reconstruction-analysis-and-visualization-of-phylogenomic-data</link>
	<title><![CDATA[ETE 3: Reconstruction, Analysis, and Visualization of Phylogenomic Data]]></title>
	<description><![CDATA[<p><span>ETE v3, featuring numerous improvements in the underlying library of methods, and providing a novel set of standalone tools to perform common tasks in comparative genomics and phylogenetics. </span></p>
<p><span>The new features include </span></p>
<p><span>(i) building gene-based and supermatrix-based phylogenies using a single command, </span></p>
<p><span>(ii) testing and visualizing evolutionary models, </span></p>
<p><span>(iii) calculating distances between trees of different size or including duplications, and </span></p>
<p><span>(iv) providing seamless integration with the NCBI taxonomy database. </span></p>
<p><span>ETE is freely available at&nbsp;</span><a href="http://etetoolkit.org/" target="">http://etetoolkit.org</a></p><p>Address of the bookmark: <a href="http://etetoolkit.org" rel="nofollow">http://etetoolkit.org</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/28566/emboss-apps</guid>
	<pubDate>Wed, 27 Jul 2016 06:00:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/28566/emboss-apps</link>
	<title><![CDATA[EMBOSS Apps]]></title>
	<description><![CDATA[<p>The programs are listed in alphabetical order, Look at the individual applications or go to the&nbsp;<a href="http://emboss.sourceforge.net/apps/release/6.6/emboss/apps/groups.html">GROUPS</a>&nbsp;page to search by category.</p>
<p><a href="http://emboss.sourceforge.net/apps/release/6.6/embassy/index.html">EMBASSY applications</a>&nbsp;are described in separate documentation for each package.</p>
<h3><a name="current" id="current"></a>Applications&nbsp;in the&nbsp;<a href="ftp://emboss.open-bio.org/pub/EMBOSS/">current release</a></h3><p>Address of the bookmark: <a href="http://emboss.sourceforge.net/apps/release/6.6/emboss/apps/" rel="nofollow">http://emboss.sourceforge.net/apps/release/6.6/emboss/apps/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/28602/srf-and-jrf-bioinformatics-at-tezpur-university-napaam</guid>
  <pubDate>Wed, 03 Aug 2016 03:47:38 -0500</pubDate>
  <link></link>
  <title><![CDATA[SRF and JRF Bioinformatics at Tezpur University, Napaam]]></title>
  <description><![CDATA[
<p>Applications are invited for the following temporary positions unde MHRD sponsored Centre of Excellence<br />in the Department of Computer Science and Engineering (CSE), Tezpur University<br /> <br />Qualification<br />and Experience : Senior Research Fellow (SRF) and JRF : First Class in M.E/M.Tech in CSE/IT/ECE with research<br />experience in relevant fields of research (Candidates having valid GATE/NET Score would be preferred).</p>

<p> <br />Fellowship: Rs. 18,000/- per month (fixed)<br /> <br />Duration : 2 (Two) years and may be extended<br />depending on status of the project<br /> <br />Age Limit: Candidates should not be more than 32 years of<br />age in case of SRF and 28 years of age in case of JRF and TA. Upper age limit may be relaxed up to 5<br />years in the case of candidate belonging to SC/ ST/ OBC/ Women/ Differently abled.<br /> <br />How to Apply:<br />Interested candidates may send their application on plain paper by post along with his/her educational<br />qualifications, research experience certificates (for SRF), 02 copies of recent passport/stamp size photographs<br />and contact phone number to Professor D.K Bhattacharyya, Principal Investigator, Department of Computer<br />Science &amp; Engineering, Tezpur University, Napaam – 784 028, or mail it to dkb@tezu.ernet.in<br />(or to smh@tezu.ernet.in) within 15 days of publication of this advertisement.<br /> <br />No TA/DA shall<br />be paid for attending the interview.<br /> <br />For more details: http://www.tezu.ernet.in/ProjectWalkin/Advt-DoRD-CSE-DKB-20-225-6779-A.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39875/lrsday-long-read-sequencing-data-analysis-for-yeasts</guid>
	<pubDate>Mon, 26 Aug 2019 18:07:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39875/lrsday-long-read-sequencing-data-analysis-for-yeasts</link>
	<title><![CDATA[LRSDAY: Long-read Sequencing Data Analysis for Yeasts]]></title>
	<description><![CDATA[<p><span>Long-read sequencing technologies have become increasingly popular in genome projects due to their strengths in resolving complex genomic regions. As a leading model organism with small genome size and great biotechnological importance, the budding yeast,&nbsp;</span><em>Saccharomyces cerevisiae</em><span>, has many isolates currently being sequenced with long reads.&nbsp;</span></p><p>Address of the bookmark: <a href="https://github.com/yjx1217/LRSDAY" rel="nofollow">https://github.com/yjx1217/LRSDAY</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/29017/walk-in-interview-jipmer</guid>
  <pubDate>Mon, 05 Sep 2016 04:01:13 -0500</pubDate>
  <link></link>
  <title><![CDATA[WALK-IN INTERVIEW @ JIPMER]]></title>
  <description><![CDATA[
<p>Department of Preventive and Social Medicine<br />, JIPMER, Puducherry –605006</p>

<p>WALK-IN INTERVIEW</p>

<p>JIP/PSM/INDO-US TB/ 2016/</p>

<p>Walk-in-interview for the following vacant posts funded by Department of Biotechnology, Govt.of India for the project entitled “Biomarkers for Risk of Tuberculosis and for Tuberculosis Treatment Failure and Relapse” in the Department of Preventive &amp; Social Medicine, JIPMER, Puducherry.</p>

<p>3. Technical Assistant</p>

<p>MCA/ MSc in Biostatistics/ MSc in Computational Biology from any recognized University @ Rs.23,220 1</p>

<p>Interested candidates may attend the walk-in interview with written screening test on 07, September 2016 at 9.30 A.M in the Dept. of Preventive and Social Medicine, IV Floor, Administrative Block, JIPMER.</p>

<p>The applicants are requested to bring the filled in application form and bio-data with original certificates for verification.</p>

<p>More Info: http://jipmer.edu.in/wp-content/uploads/2016/09/RECRUITEMENTsite-protocol-7.9.2016.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</guid>
	<pubDate>Sun, 20 Dec 2020 11:43:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</link>
	<title><![CDATA[BioJupies: Automatically Generates RNA-seq Data Analysis Notebooks]]></title>
	<description><![CDATA[<p>With BioJupies you can produce in seconds a customized, reusable, and interactive report from your own raw or processed RNA-seq data through a simple user interface</p>
<p>BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.</p><p>Address of the bookmark: <a href="https://amp.pharm.mssm.edu/biojupies/" rel="nofollow">https://amp.pharm.mssm.edu/biojupies/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44470/phyloherb-phylogenomic-analysis-pipeline-for-herbarium-specimens</guid>
	<pubDate>Wed, 21 Feb 2024 06:15:13 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44470/phyloherb-phylogenomic-analysis-pipeline-for-herbarium-specimens</link>
	<title><![CDATA[PhyloHerb: Phylogenomic Analysis Pipeline for Herbarium Specimens]]></title>
	<description><![CDATA[<p><span>What is PhyloHerb</span><span>: PhyloHerb is a wrapper program to process&nbsp;</span><span>genome skimming</span><span>&nbsp;data collected from plant materials. The outcomes include the plastid genome (plastome) assemblies, mitochondrial genome assemblies, nuclear ribosomal DNAs (NTS+ETS+18S+ITS1+5.8S+ITS2+28S), alignments of gene and intergenic regions, and a species tree. It is designed to be a high throughput program dealing with lower quality data. Examples include&nbsp;</span><span>low-coverage (5x cpDNA) plastome phylogeny, recycling plastid genes from target enrichment data, retrieving low-copy nuclear genes from medium coverage (5x nucDNA) genome skimming</span><span>.</span></p><p>Address of the bookmark: <a href="https://github.com/lmcai/PhyloHerb/" rel="nofollow">https://github.com/lmcai/PhyloHerb/</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>

</channel>
</rss>