<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29992?offset=760</link>
	<atom:link href="https://bioinformaticsonline.com/related/29992?offset=760" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/2337/clinical-genomics-informatics-europe-at-lisbon-portugal</guid>
  <pubDate>Wed, 14 Aug 2013 09:58:34 -0500</pubDate>
  <link></link>
  <title><![CDATA[Clinical Genomics &amp; Informatics Europe at Lisbon, Portugal]]></title>
  <description><![CDATA[
<p>Bio-IT World and Cambridge Healthtech Institute's fifth international Clinical Genomics &amp; Informatics Europe conference will feature four main tracks on Clinical Exome Sequencing, High Scale Computing, Genome Informatics, and RNA-Seq and Transcriptome Analysis, as well as two pre-conference symposia on Clinical Epigenetics and Quantitative Digital Detection Technologies. The conference will tackle the huge amounts of sequencing data produced by new technologies that have introduced significant challenges for bioinformatics, both in terms of the analysis and interpretation of data and clinical implementation of novel variants. Members of the international community will come together to look at the science and informatics required to utilize next generation sequencing for the molecular diagnosis of complex diseases.</p>

<p>Dated : 04 Dec 2013 - 06 Dec 2013</p>

<p>More at : http://www.clinicalgenomicsinformatics.com/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/2423/cancers-origins-revealed</guid>
	<pubDate>Thu, 15 Aug 2013 13:06:56 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/2423/cancers-origins-revealed</link>
	<title><![CDATA[Cancer's origins revealed]]></title>
	<description><![CDATA[<p>Researchers have provided the first comprehensive compendium of mutational processes that drive tumour development. Together, these mutational processes explain most mutations found in 30 of the most common cancer types. This new understanding of cancer development could help to treat and prevent a wide-range of cancers.<br /><br />More at &gt;&gt; http://www.sanger.ac.uk/about/press/2013/130814.html</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/2464/computer-theory-genetics-george-chao-at-tedxumnsalon</guid>
	<pubDate>Thu, 15 Aug 2013 22:08:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/2464/computer-theory-genetics-george-chao-at-tedxumnsalon</link>
	<title><![CDATA[Computer Theory & Genetics: George Chao at TEDxUMNSalon]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/7_GL17oiak8" frameborder="0" allowfullscreen></iframe>George Chao is an undergraduate senior studying Genetics and Computer Science at the University of Minnesota. Having started genetics research as soon as he entered the university, he has worked in labs spanning multiple disciplines as well as in Japan. Some of these researches include developmental genetics in Drosophila, computational techniques for analyzing protein interactions, and helping with the development of algorithms to analyze motion capture data of patients with neck pain. During this time, George steadily developed a fascination with the field of bioinformatics, the study of using computational techniques to learn from genetic data. He would like to go into a career of research into the application of bioinformatics in various fields.

----

The individuals involved with TEDxUMN have a passion for bringing together the great thinkers at the University of Minnesota and giving them the opportunity to share their ideas worth spreading and to discuss our shared future. We provide these great people the opportunity to share these ideas on a global stage and with an incredibly diverse audience. We believe in the power of ideas to change attitudes, lives and ultimately the world.

Check out TEDxUMN at http://www.TEDxUMN.com/

In the spirit of ideas worth spreading, TEDx is a program of local, self-organized events that bring people together to share a TED-like experience. At a TEDx event, TEDTalks video and live speakers combine to spark deep discussion and connection in a small group. These local, self-organized events are branded TEDx, where x = independently organized TED event. The TED Conference provides general guidance for the TEDx program, but individual TEDx events are self-organized.* (*Subject to certain rules and regulations)]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</guid>
	<pubDate>Wed, 05 Jun 2019 15:04:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</link>
	<title><![CDATA[Bioinformatics for Precision Oncology - Online Training Program, Summer 2019]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/05/OncologyBioinformatics.jpeg" width="600" height="337.5" alt="image" style="border: 0px;"></p><p>The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register:&nbsp;https://edu.t-bio.info/bioinformatics-training-precision-oncology/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/2680/4-positions-in-high-throughput-computational-metagenomics-and-systems-biology-of-natural-products</guid>
  <pubDate>Tue, 20 Aug 2013 08:42:29 -0500</pubDate>
  <link></link>
  <title><![CDATA[4 positions in high throughput computational metagenomics and systems biology of natural products]]></title>
  <description><![CDATA[
<p>The Research and Innovation Centre at the Fondazione Edmund Mach (CRI-FEM) is a major international research institution with strong and expanding research interests in Fruit Genomics, Quality Health and Nutrition of Agricultural Products, Agro-ecosystems Sustainability, Biodiversity and Molecular Ecology.</p>

<p>CRI-FEM hosts GMPF, an International PhD Program in Genomics and Molecular Physiology of Fruit Crops and Fox-Lab, an international initiative in forest and wood research.<br />4 positions in high throughput computational metagenomics and systems biology of natural products - deadline September 30th, 2013</p>

<p>To support interdisciplinary research, CRI-FEM has established the Computational Biology Centre (CBC).</p>

<p>The mission of CBC is to develop systems-level integrative approaches connecting genotype to phenotype with a special focus on genome-wide analyses and next generation sequencing technologies. </p>

<p>CRI-FEM is seeking to attract 4 high calibre scientists in the areas of high throughput computational metagenomics and systems biology of natural products.</p>

<p>Here below the list of the 4 positions:</p>

<p>http://www.fmach.it/eng/Servizi-Generali/Lavora-con-noi/Annunci-lavoro-e-borse-di-studio/Details-of-the-5-positions-in-high-throughput-computational-metagenomics-and-systems-biology-of-natural-products-deadline-September-30th-2013/Post-doc-in-Metagenomics-screening-and-characterization-of-bioactive-microbial-compounds-130_CRI_MSC</p>

<p>http://www.fmach.it/eng/Servizi-Generali/Lavora-con-noi/Annunci-lavoro-e-borse-di-studio/Details-of-the-5-positions-in-high-throughput-computational-metagenomics-and-systems-biology-of-natural-products-deadline-September-30th-2013/Post-doc-in-Modeling-transcriptional-control-programs-at-a-genome-wide-scale-131_CRI_TCP</p>

<p>http://www.fmach.it/eng/Servizi-Generali/Lavora-con-noi/Annunci-lavoro-e-borse-di-studio/Details-of-the-5-positions-in-high-throughput-computational-metagenomics-and-systems-biology-of-natural-products-deadline-September-30th-2013/Technologist-in-Purification-of-plant-bioactive-molecules-from-complex-matrixes-132_CRI_PBM</p>

<p>http://www.fmach.it/eng/Servizi-Generali/Lavora-con-noi/Annunci-lavoro-e-borse-di-studio/Details-of-the-5-positions-in-high-throughput-computational-metagenomics-and-systems-biology-of-natural-products-deadline-September-30th-2013/Researcher-in-Methods-for-algorithmic-and-integrative-genomics-for-metagenomics-134_CRI_AIG</p>

<p>For more information on the CBC or informal inquiries on the advertised positions please contact Dr Duccio Cavalieri (e-mail duccio.cavalieri@fmach.it).</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</guid>
	<pubDate>Thu, 24 Oct 2019 10:30:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</link>
	<title><![CDATA[IITM-Tokyo Tech Joint Symposium]]></title>
	<description><![CDATA[<p>The IITM-Tokyo Tech Joint Symposium is a biannual international symposium held in Indian Institute of Technology Madras (IITM), India in collaboration with Tokyo Institute of Technology (Tokyo-Tech), Japan. During the symposium, experts in various domains of Bioinformatics gather from India and Japan under one roof to discuss and present their works. This provides an unique opportunity to the researchers and students to learn the frontiers and interact with eminent scientists in Bioinformatics. The 5th IITM - Tokyo Tech Joint Symposium titled "Current trends in Bioinformatics: Big data analysis, machine learning and drug design", will be held on 6th - 7th March 2020 in IITM, Chennai, India.</p><p>The symposium will focus on topics in the below mentioned areas.</p><p>Topics: Algorithms for biomolecular sequences / structures Bioinformatics databases and tools Protein function Structure based drug design Machine learning Deep learning Large scale data analysis Big Data NGS Analysis Protein interactions/network Molecular modelling/docking/screening Biomolecular structure and function More</p><p>Info: https://web.iitm.ac.in/bioinfo2/symposium2020/home</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/2741/bioinformatician-dreams</guid>
	<pubDate>Wed, 21 Aug 2013 10:50:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/2741/bioinformatician-dreams</link>
	<title><![CDATA[Bioinformatician Dreams]]></title>
	<description><![CDATA[<p>Bioinformatician life is interconnected, they always dream for a powerful server, little more space on server as they are generating lots of data per run, dream to publish results in good impact journals, meetings reminders :) and research analysis off course!!!&nbsp;</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/2741" length="557537" type="image/png" />
</item>

</channel>
</rss>