<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29992?offset=980</link>
	<atom:link href="https://bioinformaticsonline.com/related/29992?offset=980" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37257/asar-advanced-metagenomic-sequence-analysis-in-r</guid>
	<pubDate>Mon, 09 Jul 2018 05:20:50 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37257/asar-advanced-metagenomic-sequence-analysis-in-r</link>
	<title><![CDATA[ASAR: Advanced metagenomic Sequence Analysis in R]]></title>
	<description><![CDATA[<p><span>An interactive data analysis tool for selection, aggregation and visualization of metagenomic data is presented. Functional analysis with a SEED hierarchy and pathway diagram based on KEGG orthology based upon MG-RAST annotation results is available.</span></p>
<p><span><span>To read the manual, please click the link&nbsp;</span><a href="https://askarbek-orakov.github.io/ASAR/">https://askarbek-orakov.github.io/ASAR/</a></span></p><p>Address of the bookmark: <a href="https://github.com/Askarbek-orakov/ASAR" rel="nofollow">https://github.com/Askarbek-orakov/ASAR</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/40228/bioinformatics-services-cro-services</guid>
	<pubDate>Wed, 06 Nov 2019 00:33:11 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/40228/bioinformatics-services-cro-services</link>
	<title><![CDATA[Bioinformatics Services / CRO Services]]></title>
	<description><![CDATA[<p>RASA is set to provide premium technical and scientific services in a form of solutions, product development and training. .We are also very proficient in providing the high quality Research &amp; Development services in life science informatics field like Next Generation Sequencing (NGS) Data Analysis,Computational Drug Discovery, Bioinformatics, Chemo-informatics and BIO-IT.</p><p>RASA offers faster, better and cost effective cutting edge technology solutions to chemical and life science research and industry. We provide our customers with A seamless model of wide expertise and comprehensive platforms. Our Value is to take our customers</p>]]></description>
	<dc:creator>RASA Life Sciences</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39875/lrsday-long-read-sequencing-data-analysis-for-yeasts</guid>
	<pubDate>Mon, 26 Aug 2019 18:07:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39875/lrsday-long-read-sequencing-data-analysis-for-yeasts</link>
	<title><![CDATA[LRSDAY: Long-read Sequencing Data Analysis for Yeasts]]></title>
	<description><![CDATA[<p><span>Long-read sequencing technologies have become increasingly popular in genome projects due to their strengths in resolving complex genomic regions. As a leading model organism with small genome size and great biotechnological importance, the budding yeast,&nbsp;</span><em>Saccharomyces cerevisiae</em><span>, has many isolates currently being sequenced with long reads.&nbsp;</span></p><p>Address of the bookmark: <a href="https://github.com/yjx1217/LRSDAY" rel="nofollow">https://github.com/yjx1217/LRSDAY</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/40503/3-phd-positions-available-in-the-area-of-bioinformaticscomputational-biology-at-ulsteracuk</guid>
  <pubDate>Thu, 02 Jan 2020 12:41:10 -0600</pubDate>
  <link></link>
  <title><![CDATA[3 PhD positions available in the area of Bioinformatics/Computational Biology at ulster.ac.uk]]></title>
  <description><![CDATA[
<p>3 PhD positions available in the area of Bioinformatics/Computational Biology, Machine Learning (ML)/Artificial Intelligence (AI), Biomarker Discovery, Stratified/Personalized Medicine in Mental Health, Diabetes and Multimorbidity. Please see details (weblinks) below:</p>

<p>1. https://www.ulster.ac.uk/doctoralcollege/find-a-phd/510894<br />2. https://www.ulster.ac.uk/doctoralcollege/find-a-phd/511458<br />3. https://www.ulster.ac.uk/doctoralcollege/find-a-phd/512618</p>

<p>Looking for students with good computational/programming skills (preferable in Linux/Shell, Python and/or R) and knowledge in computational biology and statistics. However, students from more biology oriented background but strong interest to learn bioinformatics and programming are also encouraged to apply.</p>

<p>Informal inquiries are welcomed at: p.shukla@ulster.ac.uk</p>

<p>Dr Priyank Shukla PhD FHEA FCHERP<br />Lecturer (Asst Prof) in Stratified Medicine (Bioinformatics)</p>

<p>Northern Ireland Centre for Stratified Medicine<br />Biomedical Sciences Research Institute<br />University of Ulster (Magee Campus)<br />C-TRIC Building, Altnagelvin Area Hospital<br />Glenshane Road, Derry/Londonderry<br />BT47 6SB, Northern Ireland, United Kingdom</p>

<p>T: +44 28 7167 5690<br />E: p.shukla@ulster.ac.uk<br />W: https://www.ulster.ac.uk/staff/p-shukla</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</guid>
	<pubDate>Sun, 20 Dec 2020 11:43:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</link>
	<title><![CDATA[BioJupies: Automatically Generates RNA-seq Data Analysis Notebooks]]></title>
	<description><![CDATA[<p>With BioJupies you can produce in seconds a customized, reusable, and interactive report from your own raw or processed RNA-seq data through a simple user interface</p>
<p>BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.</p><p>Address of the bookmark: <a href="https://amp.pharm.mssm.edu/biojupies/" rel="nofollow">https://amp.pharm.mssm.edu/biojupies/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/42263/data-steward-research-development-specialist-at-at-the-luxembourg-centre-for-systems-biomedicine-lcsb</guid>
  <pubDate>Sun, 25 Oct 2020 22:36:38 -0500</pubDate>
  <link></link>
  <title><![CDATA[Data Steward / Research &amp; Development Specialist at at the Luxembourg Centre for Systems Biomedicine (LCSB)]]></title>
  <description><![CDATA[
<p>Applications should be addressed online to: Prof. Dr. Reinhard Schneider, Head of the Bioinformatics Core Facility</p>

<p>For further information, please contact: Dr. Pinar Alper (pinar.alper@uni.lu)</p>

<p>Applications should be submitted online and include:</p>

<p>A detailed curriculum vitae<br />Cover letter mentioning the reference number<br />List of publications/software projects<br />Description of past experience and future interests<br />Names and addresses of three referees<br />Early application is highly encouraged, as the applications will be processed upon reception. Please apply ONLINE formally through the HR system. Applications by email will not be considered.</p>

<p>*gn=gender neutral.</p>

<p>More at https://recruitment.uni.lu/en/details.html?nPostingId=54616&amp;nPostingTargetId=74219&amp;id=QMUFK026203F3VBQB7V7VV4S8&amp;LG=UK&amp;mask=karriereseiten&amp;sType=Social%20Recruiting</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44470/phyloherb-phylogenomic-analysis-pipeline-for-herbarium-specimens</guid>
	<pubDate>Wed, 21 Feb 2024 06:15:13 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44470/phyloherb-phylogenomic-analysis-pipeline-for-herbarium-specimens</link>
	<title><![CDATA[PhyloHerb: Phylogenomic Analysis Pipeline for Herbarium Specimens]]></title>
	<description><![CDATA[<p><span>What is PhyloHerb</span><span>: PhyloHerb is a wrapper program to process&nbsp;</span><span>genome skimming</span><span>&nbsp;data collected from plant materials. The outcomes include the plastid genome (plastome) assemblies, mitochondrial genome assemblies, nuclear ribosomal DNAs (NTS+ETS+18S+ITS1+5.8S+ITS2+28S), alignments of gene and intergenic regions, and a species tree. It is designed to be a high throughput program dealing with lower quality data. Examples include&nbsp;</span><span>low-coverage (5x cpDNA) plastome phylogeny, recycling plastid genes from target enrichment data, retrieving low-copy nuclear genes from medium coverage (5x nucDNA) genome skimming</span><span>.</span></p><p>Address of the bookmark: <a href="https://github.com/lmcai/PhyloHerb/" rel="nofollow">https://github.com/lmcai/PhyloHerb/</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/42164/postdoctoral-researcher-in-statistical-bioinformatics-at-orebro-university</guid>
  <pubDate>Wed, 26 Aug 2020 10:20:11 -0500</pubDate>
  <link></link>
  <title><![CDATA[Postdoctoral Researcher in Statistical Bioinformatics at Örebro University]]></title>
  <description><![CDATA[
<p>The position is in Medical Sciences, with special focus on Statistical Bioinformatics.</p>

<p>The position is a full-time position for a fixed term of two years. The salary depends on the successful candidate’s qualifications and experience.</p>

<p>For more information, please contact Prof. Dirk Repsilber,This is an email address, Prof. Hugo Hesser, This is an email addressor Prof. Allan Sirsjö, allan.This is an email address, or Prof. Robert Brummer,This is an email address.</p>

<p>Örebro University actively pursues an equal work environment and values the qualities that diversity adds to our operations.</p>

<p>More detail at https://www.oru.se/english/working-at-orebro-university/jobs-and-vacancies/job/?jid=20200286/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/42206/pollard-lab</guid>
  <pubDate>Fri, 25 Sep 2020 20:20:50 -0500</pubDate>
  <link></link>
  <title><![CDATA[Pollard Lab]]></title>
  <description><![CDATA[
<p>We are a bioinformatics research lab focused on developing novel methods and using them to study genome evolution, organization, and regulation. Our mission is to decode biomedical knowledge that is missed without rigorous statistical approaches.</p>

<p>http://docpollard.org/</p>

<p>Tools</p>

<p>http://docpollard.org/resources/software/</p>
]]></description>
</item>

</channel>
</rss>