<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29995?offset=440</link>
	<atom:link href="https://bioinformaticsonline.com/related/29995?offset=440" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/3868/next-generation-sequencing-ngs-tutorials</guid>
	<pubDate>Sat, 24 Aug 2013 06:01:37 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/3868/next-generation-sequencing-ngs-tutorials</link>
	<title><![CDATA[Next Generation Sequencing (NGS) Tutorials]]></title>
	<description><![CDATA[<p>Institute of computational biomedicine, Cornell University provide an NGS workshop tutorial at&nbsp;<a href="http://chagall.med.cornell.edu/NGScourse/">http://chagall.med.cornell.edu/NGScourse/</a>&nbsp;</p>
<p>You can also add your favourite NGS educational material, or workshop tutorial by commenting on this bookmarks for user benefit.&nbsp;</p>
<p>Understanding the basics of genome sequencing:</p>
<p>Tutorial by Luke Jostins.</p>
<p>http://www.genetic-inference.co.uk/blog/2009/04/basics-sequencing-dna-part-1/</p>
<p>http://www.genetic-inference.co.uk/blog/2009/08/basics-sequencing-dna-part-2/</p>
<p>A window into third-generation sequencing</p>
<p>http://hmg.oxfordjournals.org/content/19/R2/R227.full.pdf</p>
<p>==============================================</p>
<p>NGS data analysis pipelines</p>
<ul>
<li><strong>Detecting and annotating genetic variations using the HugeSeq pipeline</strong>&nbsp; DOI: <a href="http://dx.doi.org/10.1038/nbt.2134">10.1038/nbt.2134</a></li>
<li><strong> NARWHAL, a primary analysis pipeline for NGS data</strong> <a href="http://bioinformatics.oxfordjournals.org/cgi/content/abstract/28/2/284?etoc">http://bioinformatics.oxfordjournals.org/cgi/content/abstract/28/2/284?etoc</a></li>
<li><strong>RseqFlow: Workflows for RNA-Seq data analysis</strong>&nbsp; DOI: <a href="http://dx.doi.org/10.1093/bioinformatics/btr441">10.1093/bioinformatics/btr441</a></li>
<li><strong>ngs_backbone: a pipeline for read cleaning, mapping and SNP calling using Next Generation Sequence</strong>&nbsp;&nbsp;<a href="http://dx.doi.org/10.1186/1471-2164-12-285">10.1186/1471-2164-12-285</a></li>
<li><strong>A framework for variation discovery and genotyping using next-generation DNA sequencing data</strong>&nbsp; PubMed: <a href="http://www.ncbi.nlm.nih.gov/pubmed/21478889">21478889</a></li>
<li><strong>SNiPlay: a web-based tool for detection, management and analysis of SNPs. Application to grapevine diversity projects</strong>&nbsp; DOI: <a href="http://dx.doi.org/10.1186/1471-2105-12-134">10.1186/1471-2105-12-134</a> Abstract: <a href="http://www.biomedcentral.com/1471-2105/12/134/abstract">http://www.biomedcentral.com/1471-2105/12/134/abstract</a></li>
<li><strong>WEP: a high-performance analysis pipeline for whole-exome data&nbsp;</strong>http://www.biomedcentral.com/1471-2105/14/S7/S11</li>
<li><strong>DDBJ read annotation pipeline: a cloud computing-based pipeline for high-throughput analysis of next-generation sequencing data.&nbsp;</strong>http://www.ncbi.nlm.nih.gov/pubmed/23657089</li>
<li><strong>GATK: a Toolkit for Genome Analysis&nbsp;</strong>http://www.broadinstitute.org/gatk/</li>
<li><strong>Metagenomics</strong>:http://www.nbic.nl/education/nbic-phd-school/course-schedule/ngsmetagenomics/</li>
<li><strong>RNASeq</strong>:http://www.nbic.nl/education/nbic-phd-school/course-schedule/ngsrnaseq/</li>
<li><strong>Bioinformatics and Seq courses</strong>:&nbsp;http://www.isb-sib.ch/training/training-activities-schedule/archive-2013.html</li>
<li><strong>Variant Detection (Model organism) Advanced tutorial</strong> https://docs.google.com/document/pub?id=1CuKkKylVDb03tnN7RSWl5EUzleetn0ctjmvaidPKLxM</li>
<li><strong>Variant Detection Introductory tutorial</strong> https://docs.google.com/document/pub?id=1ZRzrjjOCvtAu3m-IKL-rbJ1f4On60dDL_IEwG7oejdI</li>
<li><strong>Microbial de novo Assembly for Illumina Data Introductory tutorial</strong> https://docs.google.com/document/pub?id=1N3AB9ptISUu4zULqe1kXpVF0BDyGb5f5yzxWSJd_WNM</li>
<li><strong>RNAseq Differential Gene Expression Introductory tutorial</strong> https://docs.google.com/document/pub?id=1KbTiBHtvHLfPRZ39AY3uriazrINA8TJzgjjwn1zPP7Y</li>
</ul>
<blockquote>
<p>" Please add your favourite NGS link below in comment section for the benefit of bioinformatics community ".&nbsp;</p>
</blockquote><p>Address of the bookmark: <a href="http://chagall.med.cornell.edu/NGScourse/" rel="nofollow">http://chagall.med.cornell.edu/NGScourse/</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7215/postdoc-positions-in-computational-biology-center-for-genomic-science-milan-italy</guid>
  <pubDate>Thu, 12 Dec 2013 18:34:47 -0600</pubDate>
  <link></link>
  <title><![CDATA[Postdoc positions in computational biology - Center for Genomic Science - Milan, Italy]]></title>
  <description><![CDATA[
<p>Job Description: three postdoc positions in computational biology are available at the Center for Genomic Science in Milan (Italy):</p>

<p>- Development of computational methods to investigate the interplay between epigenetic and genetic layers and their role in tumor progression, by integrating genomic, epigenomic and transcriptional data. PI: Mattia Pelizzola (http://tiny.cc/comEpi)<br />- Epigenome and transcriptome analysis in mouse models of Hepatocellular Carcinoma. PI: Bruno Amati - Small and long non-coding RNAs in cancer stem cells. PI: Francesco Nicassio</p>

<p>All projects will benefit from the availability of both in-house and publicly available next-generation sequencing datasets. Familiarity with Linux environment, programming skills (especially in R) and a background in either computational biology, or physics/engineering/math will be advantageous.</p>

<p>Deadline for the application January 6th, to apply: http://genomics.iit.it/resources.html</p>

<p>Start date: March 1st, 2014</p>

<p>Duration: 1+2 years</p>

<p>Contact Person (Referent): Mattia Pelizzola</p>

<p>Ref. E-Mail: mattia.pelizzola@iit.it</p>

<p>Tel: 0039-02-94375058<br />Group Web Page: http://genomics.iit.it</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/23174/scaffolding-of-a-bacterial-genome-using-minion-nanopore-sequencing</guid>
	<pubDate>Tue, 07 Jul 2015 16:59:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/23174/scaffolding-of-a-bacterial-genome-using-minion-nanopore-sequencing</link>
	<title><![CDATA[Scaffolding of a bacterial genome using MinION nanopore sequencing]]></title>
	<description><![CDATA[<p><span>Second generation sequencing has revolutionized genomic studies. However, most genomes contain repeated DNA elements that are longer than the read lengths achievable with typical sequencers, so the genomic order of several generated contigs cannot be easily resolved. A new generation of sequencers offering substantially longer reads is emerging, notably the Pacific Biosciences (PacBio) RS II system and the MinION system, released in early 2014 by Oxford Nanopore Technologies through an early access program.</span></p><p>Address of the bookmark: <a href="http://www.nature.com/srep/2015/150707/srep11996/full/srep11996.html" rel="nofollow">http://www.nature.com/srep/2015/150707/srep11996/full/srep11996.html</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7383/embo-practical-course-on-bioinformatics-and-genomes-analyses-at-hellenic-pasteur-institute-athens-greece</guid>
  <pubDate>Sat, 21 Dec 2013 10:00:24 -0600</pubDate>
  <link></link>
  <title><![CDATA[EMBO practical Course on  "Bioinformatics and Genomes Analyses" at Hellenic Pasteur Institute, Athens, Greece]]></title>
  <description><![CDATA[
<p>The main objectives of this Practical Course are to strengthen skills <br />of PhD students and young researchers in the domain of Bioinformatics <br />and Genome Data Analyses on the use of advanced fundamental algorithms <br />and their applications in genome studies.</p>

<p>The course topics will include theoretical and practical aspects in:<br />- Genomes comparisons,<br />- Evolutionary analyses (orthologs, paralogs and ancestral genomes <br />inference),<br />- RNAseq and Next Generation Sequencing (including algorithms, methods <br />and sequence mapping tools, data analyses and applications).</p>

<p>The course programme will be centred on theoretical presentations <br />followed by practical sessions. Practical sessions in a Linux <br />environment will involve Unix shell and Perl scripting. Participants <br />are assumed to be familiar with this environment.</p>

<p>A series of lectures delivered by prominent scientists on recent hot <br />topics in genome (Viruses, Prokaryotes, Eukaryotes) studies will be <br />included in the programme and future research perspectives will be <br />highlighted.</p>

<p>The topics that will be included in the course programme are similar <br />to those included in previously organized courses:http://www.pasteur.fr/~tekaia/BGA_courses.html</p>

<p>The course is aimed at motivated Ph.D students and Post-Doctoral <br />Researchers in Academic Institutions, with background in Mathematics, <br />Statistics, Biology or Computer Science and who are involved in <br />Bioinformatics and Genomes studies.</p>

<p>Selection of participants will be based on their background, running <br />research projects and on expressed motivations.<br />Selected students will have free accommodation and meals and are <br />expected to contribute with 200 euros and to pay for their travel <br />expenses.<br />All participants (students and invited speakers) will stay in the same <br />hotel.</p>

<p>Detailed indications are available on the course web site: http://events.embo.org/14-comparative-genomics/index.html</p>

<p>Candidates are advised to complete carefully the application form, <br />together with an abstract of at least one of their running projects, a <br />"one-page CV" and a personal Identity Picture (Photo).</p>

<p>The application deadline is March 14, 2014.</p>

<p>The organizers:<br />Menelaos Manoussakis, Hellenic Pasteur Institute, Athens, Greece.<br />Evdokia Karagouni, Hellenic Pasteur Institute, Athens - Greece.<br />Evie Melanitou,  Institut Pasteur Paris - France.<br />Fredj Tekaia ( Institut Pasteur Paris France)<br />URL: http://www.pasteur.fr/~tekaia/BGA_courses.html</p>

<p>Date: 5 – 17 May, 2014. <br />More at http://events.embo.org/14-comparative-genomics/index.html<br />will take place in the ,</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/29407/live-webinar-on-rna-seq-data-analysis-on-9-nov-2016</guid>
	<pubDate>Wed, 19 Oct 2016 05:25:27 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/29407/live-webinar-on-rna-seq-data-analysis-on-9-nov-2016</link>
	<title><![CDATA[Live Webinar on RNA-Seq Data Analysis on 9 Nov 2016]]></title>
	<description><![CDATA[<p><strong><a href="http://www.strand-ngs.com/webinar_registration">Live Webinar on RNA-Seq Data Analysis</a></strong></p><p><a href="http://www.strand-ngs.com/webinar_registration">Abstract: </a>Strand NGS supports an extensive workflow for the analysis and visualization of RNA-Seq data. The workflow includes Transcriptome / Genome alignment, Differential expression analysis with Statistical approach and Splicing events detection. Strand NGS also supports novel discovery like identification of novel genes, exons and Novel splice junctions, alongside it can also detect gene fusion events. Further downstream analysis such as GO and pathway analysis can be performed on the set of interesting genes. The product has an option to create pipelines for time consuming jobs which automates analysis and leaves more time for end data interpretation. This webinar will give an overview of the features in the RNA-Seq data analysis workflow in Strand NGS and also highlights on parameters within each feature that can be optimized depending on datasets and analysis needs.</p><p><a href="http://www.strand-ngs.com/webinar_registration">Speaker:</a> Mr. Sugandan Sivamani, Senior Application Scientist, Strand Life Sciences</p><p>Date: 9th Nov, <a href="http://www.strand-ngs.com/webinar_registration">Session 1</a> for SAPK/ APFO: 2:30 PM IST Date: 9th Nov, <a href="http://www.strand-ngs.com/webinar_registration">Session 2</a> for AFO/ EMEA: 9:00 AM PST</p><p>Register here <a href="http://www.strand-ngs.com/webinar_registration">http://www.strand-ngs.com/webinar_registration</a></p>]]></description>
	<dc:creator>Strand</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/7568/oldest-hominin-dna-sequenced</guid>
	<pubDate>Fri, 27 Dec 2013 19:58:31 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/7568/oldest-hominin-dna-sequenced</link>
	<title><![CDATA[Oldest Hominin DNA Sequenced]]></title>
	<description><![CDATA[<p>Matthias Meyer and his team from the Max Planck Institute for Evolutionary Anthropology in Leipzig, Germany, have developed new techniques for retrieving and sequencing highly degraded ancient DNA. They then joined forces with Juan-Luis Arsuaga and applied the new techniques to a cave bear from the Sima de los Huesos site. After this success, the researchers sampled two grams of bone powder from a hominin thigh bone from the cave. They extracted its DNA and sequenced the genome of the mitochondria or mtDNA, a small part of the genome that is passed down along the maternal line and occurs in many copies per cell. The researchers then compared this ancient mitochondrial DNA with Neandertals, Denisovans, present-day humans, and apes.<br /><br />From the missing mutations in the old DNA sequences the researchers calculated that the Sima hominin lived about 400,000 years ago. They also found that it shared a common ancestor with the Denisovans, an extinct archaic group from Asia related to the Neandertals, about 700,000 years ago. "The fact that the mtDNA of the Sima de los Huesos hominin shares a common ancestor with Denisovan rather than Neandertal mtDNAs is unexpected since its skeletal remains carry Neandertal-derived features," says Matthias Meyer. Considering their age and Neandertal-like features, the Sima hominins were likely related to the population ancestral to both Neandertals and Denisovans. Another possibility is that gene flow from yet another group of hominins brought the Denisova-like mtDNA into the Sima hominins or their ancestors.<br /><br /></p><p>Reference</p><p>http://www.sciencedaily.com/releases/2013/12/131204132018.htm</p>]]></description>
	<dc:creator>Surajeet</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/33486/quick-next-generation-sequencing-ngs-terms-definition</guid>
	<pubDate>Fri, 09 Jun 2017 04:52:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/33486/quick-next-generation-sequencing-ngs-terms-definition</link>
	<title><![CDATA[Quick next generation sequencing (NGS) terms definition]]></title>
	<description><![CDATA[<p><strong>fragment size:</strong><span>&nbsp;the Illumina WGS protocol generates paired-end reads from both ends of longer fragments. The lengths of these fragments are assumed to be sampled from a normal distribution. Therefore, in the absence of structural variants, mapping locations of the paired ends span within an interval [&delta;min,&delta;max]. Most (&gt;90%) of paired-end reads are sampled from no-SV regions, therefore the fragment size distribution can be learned empirically for each WGS data set separately.</span><br /><br /><strong>concordant reads:</strong><span>&nbsp;a read pair is called concordant if they can be mapped to the reference genome as &ldquo;expected&rdquo;: (a) mapped to opposing strands where the upstream read is mapped to the forward strand and the downstream read is mapped to the reverse strand2, (b) the distance between ends is between the minimum and maximum expected fragment size.</span><br /><br /><strong>discordant reads:</strong><span>&nbsp;briefly, any non-concordant read pair is considered discordant. Note that, by definition, the discordant read pairs signal potential SVs. The sequence signature produced by these type of reads is known as read-pair signature.</span><br /><br /><strong>split reads:</strong><span>&nbsp;a read that can only be mapped to the reference genome by breaking into two sub-reads is called a split-read. These types of reads also indicate a potential SV or a short insertion or deletion (indel).</span><br /><br /><strong>read depth:</strong><span>&nbsp;number of reads that map within a region of the genome. Overall genome-wide read depth is also referred to as depth of coverage. It is expected that the number of reads that &ldquo;cover&rdquo; each base-pair to follow a Poisson distribution. Therefore, if the read depth over a certain region deviates significantly from this distribution, it signals for a potential copy number variation (CNV).</span></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/7986/list-of-bioinformatics-open-source-projectssoftware</guid>
	<pubDate>Tue, 21 Jan 2014 14:28:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/7986/list-of-bioinformatics-open-source-projectssoftware</link>
	<title><![CDATA[List of bioinformatics open source projects/software.]]></title>
	<description><![CDATA[<p>Open source software is software that can be freely used, changed, and shared (in modified or unmodified form) by anyone. Open source software is made by many people, and distributed under licenses that comply with the Open Source Definition.The Open Source Initiative (OSI) is a global non-profit that supports and promotes the open source movement. Followings are the OS bioinformatics projects/software :</p><p><strong>.NET Bio</strong></p><p>http://blogs.msdn.com/b/msr_er/archive/2011/10/18/microsoft-biology-foundation-evolves-into-new-toolkit-net-bio.aspx</p><p>A language-neutral bioinformatics toolkit built using the Microsoft 4.0 .NET Framework to help developers, researchers, and scientists.</p><p><strong>AMPHORA</strong> ("AutoMated Phylogenomic infeRence Application")</p><p>http://wolbachia.biology.virginia.edu/WuLab/Software.html</p><p><a href="http://en.wikipedia.org/wiki/Metagenomics" title="Metagenomics">Metagenomics</a> analysis software</p><p><strong>Anduril</strong></p><p>http://www.anduril.org/anduril/site/</p><p>Component-based <a href="http://en.wikipedia.org/wiki/Workflow" title="Workflow">workflow</a> framework for data analysis</p><p>Armadillo workflow platform</p><p>Tool for designing and executing phylogenetic workflows</p><p><strong>AutoDock</strong></p><p>http://autodock.scripps.edu/</p><p>suite of automated docking tools</p><p><strong>Biochemical Algorithms Library (BALL)</strong></p><p>http://www.ball-project.org/</p><p>C++ library and framework for molecular modeling and visualization designed for rapid prototyping</p><p><strong>Bio4j</strong></p><p>http://bio4j.com/</p><p>Bio4j is a <a href="http://en.wikipedia.org/wiki/Bioinformatics" title="Bioinformatics">bioinformatics</a> platform and <a href="http://en.wikipedia.org/wiki/Chart" title="Chart">graph</a> based <a href="http://en.wikipedia.org/wiki/Database" title="Database">database</a> built around most data available in <a href="http://en.wikipedia.org/wiki/UniProt" title="UniProt">UniProt</a> KB(<a href="http://en.wikipedia.org/wiki/Swiss-Prot" title="Swiss-Prot">Swiss-Prot</a> + <a href="http://en.wikipedia.org/wiki/TrEMBL" title="TrEMBL">TrEMBL</a>), <a href="http://en.wikipedia.org/wiki/Gene_Ontology" title="Gene Ontology">Gene Ontology</a> (GO), <a href="http://en.wikipedia.org/w/index.php?title=UniRef&amp;action=edit&amp;redlink=1" title="UniRef (page does not exist)">UniRef</a> (50,90,100), <a href="http://en.wikipedia.org/wiki/RefSeq" title="RefSeq">RefSeq</a>, <a href="http://en.wikipedia.org/wiki/National_Center_for_Biotechnology_Information" title="National Center for Biotechnology Information">NCBI</a> taxonomy, and Expasy Enzyme DB</p><p><strong>Bioclipse</strong></p><p>www.bioclipse.net</p><p>Visual platform for <a href="http://en.wikipedia.org/wiki/Cheminformatics" title="Cheminformatics">chemo</a>- and <a href="http://en.wikipedia.org/wiki/Bioinformatics" title="Bioinformatics">bioinformatics</a> based on the <a href="http://en.wikipedia.org/wiki/Eclipse_%28software%29" title="Eclipse (software)">Eclipse</a> Rich Client Platform (RCP).</p><p><strong>Bioconductor</strong></p><p>http://www.bioconductor.org/</p><p><a href="http://en.wikipedia.org/wiki/R_%28programming_language%29" title="R (programming language)">R (programming language)</a> language toolkit</p><p><strong>Bioinformatics Learning Tutorial (BLT)</strong></p><p>http://sourceforge.net/projects/biotutorial/</p><p>Educational <a href="http://en.wikipedia.org/wiki/Interactive_tutorials" title="Interactive tutorials">interactive tutorials</a> and 3D animations for Replication, Transcription, and Translation</p><p><strong>BioHaskell</strong></p><p>http://biohaskell.org/</p><p><a href="http://en.wikipedia.org/wiki/Haskell_%28programming_language%29" title="Haskell (programming language)">Haskell (programming language)</a></p><p><strong>BioJava</strong></p><p>http://biojava.org/wiki/Main_Page</p><p><a href="http://en.wikipedia.org/wiki/Java_%28programming_language%29" title="Java (programming language)">Java (programming language)</a></p><p><strong>BioMOBY</strong></p><p>http://biomoby.org/</p><p>registry of <a href="http://en.wikipedia.org/wiki/Web_services" title="Web services">web services</a></p><p><strong>BioPerl</strong></p><p>http://www.bioperl.org/wiki/Main_Page</p><p><a href="http://en.wikipedia.org/wiki/Perl" title="Perl">Perl</a> language toolkit</p><p><strong>BioPHP</strong></p><p>http://www.biophp.org/</p><p><a href="http://en.wikipedia.org/wiki/PHP" title="PHP">PHP</a> language toolkit</p><p><strong>Biopython</strong></p><p>http://biopython.org/wiki/Main_Page</p><p><a href="http://en.wikipedia.org/wiki/Python_%28programming_language%29" title="Python (programming language)">Python</a> language toolkit</p><p><strong>BioRails</strong></p><p>https://github.com/biorails</p><p>a <a href="http://en.wikipedia.org/wiki/Data_management_system" title="Data management system">data management system</a> designed to support researchers in <a href="http://en.wikipedia.org/wiki/Drug_discovery" title="Drug discovery">drug discovery</a></p><p><strong>BioRuby</strong></p><p>http://bioruby.org/</p><p><a href="http://en.wikipedia.org/wiki/Ruby_%28programming_language%29" title="Ruby (programming language)">Ruby</a> language toolkit</p><p><strong>BioSmalltalk</strong></p><p>https://code.google.com/p/biosmalltalk/</p><p><a href="http://en.wikipedia.org/wiki/Smalltalk_%28programming_language%29" title="Smalltalk (programming language)">Smalltalk</a> language toolkit</p><p><strong>BioUno</strong></p><p>http://www.biouno.org/</p><p><a href="http://en.wikipedia.org/w/index.php?title=BioUno&amp;action=edit&amp;redlink=1" title="BioUno (page does not exist)">BioUno</a> is a project that applies <a href="http://en.wikipedia.org/wiki/Continuous_Integration" title="Continuous Integration">Continuous Integration</a> tools and techniques in <a href="http://en.wikipedia.org/wiki/Bioinformatics" title="Bioinformatics">Bioinformatics</a>. It uses <a href="http://en.wikipedia.org/wiki/Jenkins_%28software%29" title="Jenkins (software)">Jenkins</a> and its plug-in API to create <a href="http://en.wikipedia.org/wiki/Bioinformatics_workflow_management_system" title="Bioinformatics workflow management system">biology workflows</a> and manage <a href="http://en.wikipedia.org/wiki/Computer_clusters" title="Computer clusters">computer clusters</a>.</p><p><strong>caCORE</strong></p><p>&nbsp;</p><p>ontologic representation environment</p><p><strong>caArray</strong></p><p>https://cabig-stage.nci.nih.gov/community/tools/caArray</p><p>ontologic representation environment</p><p><strong>EMBOSS</strong></p><p>http://emboss.sourceforge.net/</p><p>Suite of packages for sequencing, searching, etc.</p><p><strong>Gaggle</strong></p><p>https://www.gaggle.net/</p><p>A framework for interoperability between systems biology software</p><p><strong>Galaxy</strong></p><p>http://galaxyproject.org/</p><p><a href="http://en.wikipedia.org/wiki/Scientific_workflow_system" title="Scientific workflow system">Scientific workflow</a> and <a href="http://en.wikipedia.org/wiki/Data_integration" title="Data integration">data integration</a> system</p><p><strong>GenePattern</strong></p><p>http://www.broadinstitute.org/cancer/software/genepattern/</p><p><a href="http://en.wikipedia.org/wiki/Scientific_workflow_system" title="Scientific workflow system">Scientific workflow system</a> that provides access to more than 150 genomic analysis tools</p><p><strong>GeWorkbench</strong></p><p>http://wiki.c2b2.columbia.edu/workbench/index.php/Home</p><p>Genomic <a href="http://en.wikipedia.org/wiki/Data_integration" title="Data integration">data integration</a> platform</p><p><strong>GMOD</strong></p><p>http://www.gmod.org/wiki/Main_Page</p><p>Toolkit for addressing many common challenges at biological databases.</p><p><strong>GeneProf</strong></p><p>http://www.geneprof.org/GeneProf/</p><p>A web-based, bioinformatics software suite for the analysis of functional genomics experiments, e.g. RNA-seq or ChIP-seq.</p><p><strong>GeneTalk</strong></p><p>http://www.gene-talk.de/</p><p>Tool for filtering sequence variants in <a href="http://en.wikipedia.org/wiki/Variant_Call_Format" title="Variant Call Format">VCF</a> files. Network for scientists and clinicians for expertise and knowledge exchange. Database of annotations aboute sequence variants with clinically relevant information.</p><p><strong>GenGIS</strong></p><p>http://kiwi.cs.dal.ca/GenGIS/Main_Page</p><p>Application that allows users to combine digital map data with information about biological sequences collected from the environment.</p><p><strong>GenomeSpace</strong></p><p>http://www.genomespace.org/</p><p>Centralized web application that provides data format transformations and facilitates connections with other bioinformatics tools</p><p><strong>GENtle</strong></p><p>http://directory.fsf.org/wiki/GENtle</p><p>An equivalent to the proprietary <a href="http://en.wikipedia.org/wiki/Vector_NTI" title="Vector NTI">Vector NTI</a>, a tool to analyze and edit <a href="http://en.wikipedia.org/wiki/DNA" title="DNA">DNA</a> sequence files</p><p><strong>Integrated Genome Browser</strong></p><p>http://bioviz.org/igb/</p><p><a href="http://en.wikipedia.org/wiki/Java_%28software_platform%29" title="Java (software platform)">Java</a>-based desktop <a href="http://en.wikipedia.org/wiki/Genome_browser" title="Genome browser">genome browser</a></p><p><strong>Integrative Genomics Viewer (IGV)</strong></p><p>http://www.broadinstitute.org/igv/</p><p>High-performance desktop tool for interactive visual exploration of diverse genomic data</p><p><strong>IntAct</strong></p><p>http://www.ebi.ac.uk/intact/</p><p>molecular interaction database</p><p><strong>InterMine</strong></p><p>http://intermine.github.io/intermine.org/</p><p>Extensive data warehouse system for the analysis and integration of biological datasets</p><p><strong>Java Treeview</strong></p><p>http://jtreeview.sourceforge.net/</p><p>microarray data viewer</p><p><strong>LabKey Server</strong></p><p>http://labkey.com/</p><p>platform for integrating, analyzing and sharing data</p><p><strong>OpenClinica</strong></p><p>https://www.openclinica.com/</p><p>software for capturing and managing data in clinical trials</p><p><a href="http://www.biomedcentral.com/1471-2164/13/512">PromKappa</a></p><p>http://xbioinformatics.wordpress.com/tag/promkappa/</p><p>PromKappa (Promoter analysis by Kappa) software program used for promoter pattern generation and promoter analysis.</p><p><strong>MeV: Multi-Experiment Viewer</strong></p><p>http://www.tm4.org/mev.html</p><p>a desktop application for the analysis, visualization and data-mining of large-scale genomic data</p><p><strong>PathVisio</strong></p><p>http://www.pathvisio.org/</p><p>a desktop software for drawing, analysis and visualization of biological pathways</p><p>REDCRAFT</p><p>software for determining tertiary protein structure given assigned Residual Dipolar Coupling data</p><p>SAM Tools</p><p>Data format (SAM) and accompanying tool suite, for storing large nucleotide sequence alignments</p><p><a href="http://en.wikipedia.org/wiki/Staden_Package" title="Staden Package">Staden Package</a></p><p>Sequence assembly, editing and analysis, primarily consisting of gap4, gap5 and spin.</p><p><a href="http://en.wikipedia.org/wiki/STAMP" title="STAMP">STAMP</a></p><p>Software package for analyzing metagenomic profiles that promotes &lsquo;best practices&rsquo; in choosing appropriate statistical techniques and reporting results.</p><p><a href="http://supfam.org/supraHex">supraHex</a></p><p>An open-source R/Bioconductor package for omics data analysis using a supra-hexagonal map</p><p><a href="http://en.wikipedia.org/wiki/Taverna_workbench" title="Taverna workbench">Taverna workbench</a></p><p>Tool for designing and executing workflows</p><p>TGAC Browser</p><p>Genome Browser, visualisation solutions for big data in the genomic era</p><p>T-REX WebServer</p><p>Bioinformatics and phylogenetics webserver (NJ, PhyML, RAxML, MAFFT, MUSCLE, Newick viewer, <a href="http://en.wikipedia.org/wiki/Horizontal_gene_transfer" title="Horizontal gene transfer">Horizontal gene transfer</a> detection, Reticulograms, Substitution models)</p><p><a href="http://en.wikipedia.org/wiki/UGENE" title="UGENE">UGENE</a></p><p>integrated bioinformatics tools</p><p>Visomics</p><p>bioinformatics tools for omics data</p><p>Genome Analysis Toolkit 1.0 (GATK 1.0)</p><p>a software package to analyse next-generation resequencing data</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/35621/bbtools-for-bioinformatician</guid>
	<pubDate>Thu, 15 Feb 2018 16:45:52 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/35621/bbtools-for-bioinformatician</link>
	<title><![CDATA[BBTools for bioinformatician !]]></title>
	<description><![CDATA[<p><span></span><br /><strong>BBMap.sh</strong><br /><br /></p><ul>
<li><strong>Mapping Nanopore reads</strong></li>
</ul><p><br /><span>BBMap.sh has a length cap of 6kbp. Reads longer than this will be broken into 6kbp pieces and mapped independently.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ mapPacBio.sh -Xmx20g k=7 in=reads.fastq ref=reference.fa maxlen=1000 minlen=200 idtag ow int=f qin=33 out=mapped1.sam minratio=0.15 ignorequality slow ordered maxindel1=40 maxindel2=400</pre></div><p><br /><span>The "maxlen" flag shreds them to a max length of 1000; you can set that up to 6000. But I found 1000 gave a higher mapping rate.&nbsp;&nbsp;</span><br /><br /></p><ul>
<li><strong>Using Paired-end and single-end reads at the same time</strong></li>
</ul><p><br /><span>BBMap itself can only run single-ended or paired-ended in a single run, but it has a wrapper that can accomplish it, like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbwrap.sh in1=read1.fq,singletons.fq in2=read2.fq,null out=mapped.sam append</pre></div><p><span>This will write all the reads to the same output file but only print the headers once. I have not tried that for bam output, only sam output</span><br /><br /><span>Note about alignment stats: For paired reads, you can find the total percent mapped by adding the read 1 percent (where it says "mapped: N%") and read 2 percent, then dividing by 2. The different columns tell you the count/percent of each event. Considering the cigar strings from alignment, "Match Rate" is the number of symbols indicating a reference match (=) and error rate is the number indicating substitution, insertion, or deletion (X, I, D).</span><br /><br /></p><ul>
<li><strong>Exact matches when mapping small reads (e.g. miRNA)</strong></li>
</ul><p><br /><span>When mapping small RNA's with BBMap use the following flags to report only perfect matches.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">ambig=all vslow perfectmode maxsites=1000</pre></div><p><span>It should be very fast in that mode (despite the vslow flag). Vslow mainly removes masking of low-complexity repetitive kmers, which is not usually a problem but can be with extremely short sequences like microRNAs.</span></p><ul>
<li><strong>Important note about BBMap alignments</strong></li>
</ul><p><br /><span>BBMap is always nondeterministic when run in paired-end mode with multiple threads, because the insert-size average is calculated on a per-thread basis, which affects mapping; and which reads are assigned to which thread is nondeterministic. The only way to avoid that would be to restrict it to a single thread (threads=1), or map the reads as single-ended and then fix pairing afterward:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">bbmap.sh in=reads.fq outu=unmapped.fq int=f
repair.sh in=unmapped.fq out=paired.fq fint outs=singletons.fq</pre></div><p><span>In this case you'd want to only keep the paired output.&nbsp;</span><br /><br /><span>BBSplit is based on BBMap, so it is also nondeterministic in paired mode with multiple threads. BBDuk and Seal (which can be used similarly to BBSplit) are always deterministic.&nbsp;</span><br /><br /><span>--------------------------------------------------------</span><br /><br /><strong>Reformat.sh</strong></p><ul>
<li><strong>Count k-mers/find unknown primers</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fq out=trimmed.fq ftr=19</pre></div><p><span>This will trim all but the first 20 bases (all bases after position 19, zero-based).</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ kmercountexact.sh in=trimmed.fq out=counts.txt fastadump=f mincount=10 k=20 rcomp=f</pre></div><p><span>This will generate a file containing the counts of all 20-mers that occurred at least 10 times, in a 2-column format that is easy to sort in Excel.&nbsp;</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">ACCGTTACCGTTACCGTTAC	100
AAATTTTTTTCCCCCCCCCC	85</pre></div><p><span>...etc. If the primers are 20bp long, they should be pretty obvious.&nbsp;&nbsp;</span></p><ul>
<li><strong>Convert SAM format from 1.4 to 1.3 (required for many programs)</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.sam out=out.sam sam=1.3</pre></div><ul>
<li><strong>Removing N basecalls</strong></li>
</ul><p><br /><span>You can use BBDuk or Reformat with "qtrim=rl trimq=1". That will only trim trailing and leading bases with Q-score below 1, which means Q0, which means N (in either fasta or fastq format). The BBMap package automatically changes q-scores of Ns that are above 0 to 0 and called bases with q-scores below 2 to 2, since occasionally some Illumina software versions produces odd things like a handful of Q0 called bases or Ns with Q&gt;0, neither of which make any sense in the Phred scale.</span></p><ul>
<li><strong>Sampling reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fq out=sampled.fq sample=3000</pre></div><div><div>Code:</div><pre dir="ltr">To sample 10% of the reads:
reformat.sh in1=reads1.fq in2=reads2.fq out1=sampled1.fq out2=sampled2.fq samplerate=0.1

or more concisely:
reformat.sh in=reads#.fq out=sampled#.fq samplerate=0.1

and for exact sampling:
reformat.sh in=reads#.fq out=sampled#.fq samplereadstarget=100k</pre></div><ul>
<li><strong>Changing fasta headers</strong></li>
</ul><p><br /><span>Remove anything after the first space in fasta header.&nbsp;</span><br /><br /></p><div><div>Code:</div><pre dir="ltr"> reformat.sh in=sequences.fasta out=renamed.fasta trd</pre></div><p><span>"trd" stands for "trim read description" and will truncate everything after the first whitespace.</span></p><ul>
<li><strong>Extract reads from a sam file</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.sam out=reads.fastq</pre></div><ul>
<li><strong>Verify pairing and optionally de-interleave the reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fastq verifypairing</pre></div><ul>
<li><strong>Verify pairing if the reads are in separate files</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in1=r1.fq in2=r2.fq vpair</pre></div><p><span>If that completes successfully and says the reads were correctly paired, then you can simply de-interleave reads into two files like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fastq out1=r1.fastq out2=r2.fastq</pre></div><ul>
<li><strong>Base quality histograms</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fq qchist=qchist.txt</pre></div><p><span>That stands for "quality count histogram".&nbsp;</span></p><ul>
<li><strong>Filter SAM/BAM file by read length</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=x.sam out=y.sam minlength=50 maxlength=200</pre></div><ul>
<li><strong>Filter SAM/BAM file to detect/filter spliced reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=mapped.bam out=filtered.bam maxdellen=50</pre></div><p><span>You can set "maxdellen" to whatever length deletion event you consider the minimum to signify splicing, which depends on the organism.</span><br /><span>-------------------------------------------------------------</span><br /><strong>Repair.sh</strong></p><ul>
<li><strong>"Re-pair" out-of-order reads from paired-end data files</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ repair.sh in1=r1.fq.gz in2=r2.fq.gz out1=fixed1.fq.gz out2=fixed2.fq.gz outsingle=singletons.fq.gz</pre></div><p><span>--------------------------------------------------------------</span><br /><strong>BBMerge.sh</strong><br /><br /><span>BBMerge now has a new flag - "outa" or "outadapter". This allows you to automatically detect the adapter sequence of reads with short insert sizes, in case you don't know what adapters were used. It works like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbmerge.sh in=reads.fq outa=adapters.fa reads=1m</pre></div><p><span>Of course, it will only work for paired reads! The output fasta file will look like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">&gt;Read1_adapter
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
&gt;Read2_adapter
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG</pre></div><p><span>If you have multiplexed things with different barcodes in the adapters, the part with the barcode will show up as Ns, like this:</span><br /><br /><span>GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG&nbsp;&nbsp;</span><br /><br /><span>Note: For BBMerge with micro-RNA, you need to add the flag&nbsp;</span><strong>mininsert=17</strong><span>. The default is 35, which is too long for micro-RNA libraries.&nbsp;</span></p><ul>
<li><strong>Identifying adapters</strong></li>
</ul><p><span>If you have paired reads, and enough of the reads have inserts shorter than read length, you can identify adapter sequences with BBMerge, like this (they will be printed to adapters.fa):</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbmerge.sh in1=r1.fq in2=r2.fq outa=adapters.fa</pre></div><p><br /><span>-----------------------------------------------------------------</span><br /><br /><strong>BBDuk.sh</strong><br /><br /><span>Note: BBDuk is strictly deterministic on a per-read basis, however it does by default reorder the reads when run multithreaded. You can add the flag "ordered" to keep output reads in the same order as input reads</span></p><ul>
<li><strong>Finding reads with a specific sequence at the beginning of read</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ bbduk.sh -Xmx1g in=reads.fq outm=matched.fq outu=unmatched.fq restrictleft=25 k=25 literal=AAAAACCCCCTTTTTGGGGGAAAAA</pre></div><p><span>In this case, all reads starting with "AAAAACCCCCTTTTTGGGGGAAAAA" will end up in "matched.fq" and all other reads will end up in "unmatched.fq". Specifically, the command means "look for 25-mers in the leftmost 25 bp of the read", which will require an exact prefix match, though you can relax that if you want.</span><br /><br /><span>So you could bin all the reads with your known sequence, then look at the remaining reads to see what they have in common. You can do the same thing with the tail of the read using "restrictright" instead, though you can't use both restrictions at the same time.&nbsp;&nbsp;</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbduk.sh in=reads.fq outm=matched.fq literal=NNNNNNCCCCGGGGGTTTTTAAAAA k=25 copyundefined</pre></div><p><span>With the "copyundefined" flag, a copy of each reference sequence will be made representing every valid combination of defined letter. So instead of increasing memory or time use by 6^75, it only increases them by 4^6 or 4096 which is completely reasonable, but it only allows substitutions at predefined locations. You can use the "copyundefined", "hdist", and "qhdist" flags together for a lot of flexibility - for example, hdist=2 qhdist=1 and 3 Ns in the reference would allow a hamming distance of 6 with much lower resource requirements than hdist=6. Just be sure to give BBDuk as much memory as possible.</span></p><ul>
<li><strong>Removing illumina adapters (if exact adapters not known)</strong></li>
</ul><p><br /><span>If you're not sure which adapters are used, you can add "ref=truseq.fa.gz,truseq_rna.fa.gz,nextera.fa.gz" and get them all (this will increase the amount of overtrimming, though it should still be negligible).&nbsp;</span></p><ul>
<li><strong>Removing illumina control sequences/phiX reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">bbduk.sh in=trimmed.fq.gz out=filtered.fq.gz k=31 ref=artifacts,phix ordered cardinality</pre></div><ul>
<li><strong>Identify certain reads that contain a specific sequence</strong></li>
</ul><div><div>Code:</div><pre dir="ltr">$ bbduk.sh in=reads.fq out=unmatched.fq outm=matched.fq literal=ACGTACGTACGTACGTAC k=18 mm=f hdist=2</pre></div><p><span>Make sure "k" is set to the exact length of the sequence. "hdist" controls the number of substitutions allowed. "outm" gets the reads that match. By default this also looks for the reverse-complement; you can disable that with "rcomp=f".&nbsp;&nbsp;</span></p><ul>
<li><strong>Extract sequences that share kmers with your sequences with BBDuk</strong></li>
</ul><div><div>Code:</div><pre dir="ltr">$ bbduk.sh in=a.fa ref=b.fa out=c.fa mkf=1 mm=f k=31</pre></div><p><span>This will print to C all the sequences in A that share 100% of their 31-mers with sequences in B.&nbsp;</span><br /><br /></p><ul>
<li><strong>Extract sequences that contain N's with BBDuk</strong></li>
</ul><div><div>Code:</div><pre dir="ltr">bbduk.sh in=reads.fq out=readsWithoutNs.fq outm=readsWithNs.fq maxns=0</pre></div><p><span>If you have, say, 100bp reads and only want to separate reads containing all 100 Ns, change that to "maxns=99".</span><br /><br /><strong>General notes for BBDuk.sh</strong><span>&nbsp;</span><br /><br /><span>BBDuk can operate in one of 4 kmer-matching modes:</span><br /><span>Right-trimming (ktrim=r), left-trimming (ktrim=l), masking (ktrim=n), and filtering (default). But it can only do one at a time because all kmers are stored in a single table. It can still do non-kmer-based operations such as quality trimming at the same time.</span><br /><br /><span>BBDuk2 can do all 4 kmer operations at once and is designed for integration into automated pipelines where you do contaminant removal and adapter-trimming in a single pass to minimize filesystem I/O. Personally, I never use BBDuk2 from the command line. Both have identical capabilities and functionality otherwise, but the syntax is different.</span><br /><br /><span>------------------------------------------------------------------</span><br /><br /><strong>Randomreads.sh</strong></p><ul>
<li><strong>Generate random reads in various formats</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ randomreads.sh ref=genome.fasta out=reads.fq len=100 reads=10000</pre></div><p><span>You can specify paired reads, an insert size distribution, read lengths (or length ranges), and so forth. But because I developed it to benchmark mapping algorithms, it is specifically designed to give excellent control over mutations. You can specify the number of snps, insertions, deletions, and Ns per read, either exactly or probabilistically; the lengths of these events is individually customizable, the quality values can alternately be set to allow errors to be generated on the basis of quality; there's a PacBio error model; and all of the reads are annotated with their genomic origin, so you will know the correct answer when mapping.</span><br /><br /><span>Bear in mind that 50% of the reads are going to be generated from the plus strand and 50% from the minus strand. So, either a read will match the reference perfectly, OR its reverse-complement will match perfectly.</span><br /><br /><span>You can generate the same set of reads with and without SNPs by fixing the seed to a positive number, like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ randomreads.sh maxsnps=0 adderrors=false out=perfect.fastq reads=1000 minlength=18 maxlength=55 seed=5

$ randomreads.sh maxsnps=2 snprate=1 adderrors=false out=2snps.fastq reads=1000 minlength=18 maxlength=55 seed=5</pre></div><p><span>[As of BBmap v. 36.59] rendomreads.sh gains the ability to simulate metagenomes.&nbsp;</span><br /><br /><span>coverage=X will automatically set "reads" to a level that will give X average coverage (decimal point is allowed).</span><br /><br /><span>metagenome will assign each scaffold a random exponential variable, which decides the probability that a read be generated from that scaffold. So, if you concatenate together 20 bacterial genomes, you can run randomreads and get a metagenomic-like distribution. It could also be used for RNA-seq when using a transcriptome reference.</span><br /><br /><span>The coverage is decided on a per-reference-sequence level, so if a bacterial assembly has more than one contig, you may want to glue them together first with fuse.sh before concatenating them with the other references.&nbsp;</span><br /><br /></p><ul>
<li><strong>Simulate a jump library</strong></li>
</ul><p><br /><span>You can simulate a 4000bp jump library from your existing data like this.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ cat assembly1.fa assembly2.fa &gt; combined.fa
$ bbmap.sh ref=combined.fa
$ randomreads.sh reads=1000000 length=100 paired interleaved mininsert=3500 maxinsert=4500 bell perfect=1 q=35 out=jump.fq.gz</pre></div><p><span>--------------------------------------------------------------</span><br /><strong>Shred.sh</strong><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ shred.sh in=ref.fasta out=reads.fastq length=200</pre></div><p><span>The difference is that RandomReads will make reads in a random order from random locations, ensuring flat coverage on average, but it won't ensure 100% coverage unless you generate many fold depth. Shred, on the other hand, gives you exactly 1x depth and exactly 100% coverage (and is not capable of modelling errors). So, the use-cases are different.&nbsp;</span><br /><span>---------------------------------------------------------------</span><br /><strong>Demuxbyname.sh</strong></p><ul>
<li><strong>Demultiplex fastq files when the tag is present in the fastq read header (illumina)</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ demuxbyname.sh in=r#.fq out=out_%_#.fq prefixmode=f names=GGACTCCT+GCGATCTA,TAAGGCGA+TCTACTCT,...
outu=filename</pre></div><p><span>"Names" can also be a text file with one barcode per line (in exactly the format found in the read header). You do have to include all of the expected barcodes, though.</span><br /><br /><span>In the output filename, the "%" symbol gets replaced by the barcode; in both the input and output names, the "#" symbol gets replaced by 1 or 2 for read 1 or read 2. It's optional, though; you can leave it out for interleaved input/output, or specify in1=/in2=/out1=/out2= if you want custom naming.</span><br /><br /><span>----------------------------------------------------------------</span><br /><br /><strong>Readlength.sh</strong></p><ul>
<li><strong>Plotting the length distribution of reads</strong></li>
</ul><div><div>Code:</div><pre dir="ltr">$ readlength.sh in=file out=histogram.txt bin=10 max=80000</pre></div><p><span>That will plot the result in bins of size 10, with everything above 80k placed in the same bin. The defaults are set for relatively short sequences so if they are many megabases long you may need to add the flag "-Xmx8g" and increase "max=" to something much higher.</span><br /><br /><span>Alternatively, if these are assemblies and you're interested in continuity information (L50, N50, etc), you can run stats on each or statswrapper on all of them:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">stats.sh in=file</pre></div><p><span>or</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">statswrapper.sh in=file,file,file,file&hellip;</pre></div><p><span>----------------------------------------------------------------</span><br /><strong>Filterbyname.sh</strong><br /><br /><span>By default, "filterbyname" discards reads with names in your name list, and keeps the rest. To include them and discard the others, do this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ filterbyname.sh in=003.fastq out=filter003.fq names=names003.txt include=t</pre></div><p><span>----------------------------------------------------------------</span><br /><strong>getreads.sh</strong><br /><br /><span>If you only know the number(s) of the fasta/fastq record(s) in a file (records start at 0) then you can use the following command to extract those reads in a new file.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ getreads.sh in= id=&lt;number,number,number...&gt; out=</pre></div><p><span>The first read (or pair) has ID 0, the second read (or pair) has ID 1, etc.</span><br /><br /><span>Parameters:</span><br /><span>in= Specify the input file, or stdin.</span><br /><span>out= Specify the output file, or stdout.</span><br /><span>id= Comma delimited list of numbers or ranges, in any order.</span><br /><span>For example: id=5,93,17-31,8,0,12-13&nbsp;</span><br /><span>----------------------------------------------------------------</span><br /><strong>Splitsam.sh</strong></p><ul>
<li><strong>Splits a sam file into forward and reverse reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">splitsam.sh mapped.sam plus.sam minus.sam unmapped.sam
reformat.sh in=plus.sam out=plus.fq
reformat.sh in=minus.sam out=minus.fq rcomp</pre></div><p><span>----------------------------------------------------------------</span><br /><strong>BBSplit.sh</strong><br /><br /><span>BBSplit now has the ability to output paired reads in dual files using the # symbol. For example:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbsplit.sh ref=x.fa,y.fa in1=read1.fq in2=read2.fq basename=o%_#.fq</pre></div><p><span>will produce ox_1.fq, ox_2.fq, oy_1.fq, and oy_2.fq</span><br /><br /><span>You can use the # symbol for input also, like "in=read#.fq", and it will get expanded into 1 and 2.&nbsp;&nbsp;</span><br /><br /><strong>Added feature:&nbsp;</strong><span>One can specify a directory for the "ref=" argument. If anything in the list is a directory, it will use all fasta files in that directory. They need a fasta extension, like .fa or .fasta, but can be compressed with an additional .gz after that. Reason this is useful is to use BBSplit is to have it split input into one output file per reference file.</span><br /><br /><br /><strong>NOTE: 1</strong><span>&nbsp;By default BBSplit uses fairly strict mapping parameters; you can get the same sensitivity as BBMap by adding the flags "minid=0.76 maxindel=16k minhits=1". With those parameters it is extremely sensitive.</span><br /><br /><strong>NOTE: 2</strong><span>&nbsp;BBSplit has different ambiguity settings for dealing with reads that map to multiple genomes. In any case, if the alignment score is higher to one genome than another, it will be associated with that genome only (this considers the combined scores of read pairs - pairs are always kept together). But when a read or pair has two identically-scoring mapping locations, on different genomes, the behavior is controlled by the "ambig2" flag - "ambig2=toss" will discard the read, "all" will send it to all output files, and "split" will send it to a separate file for ambiguously-mapped reads (one per genome to which it maps).</span><br /><br /><strong>NOTE: 3</strong><span>&nbsp;Zero-count lines are suppressed by default, but they should be printed if you include the flag "nzo=f" (nonzeroonly=false).&nbsp;</span><br /><br /><strong>NOTE: 4</strong><span>&nbsp;BBSplit needs multiple reference files as input; one per organism, or one for target and another for everything else. It only outputs one file per reference file.</span><br /><br /><span>Seal.sh, on the other hand, which is similar, can use a single concatenated file, as it (by default) will output one file per reference sequence within a concatenated set of references.&nbsp;</span><br /><span>--------------------------------------------------------------</span><br /><strong>Pileup.sh</strong></p><ul>
<li><strong>To generate transcript coverage stats</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ pileup.sh in=mapped.sam normcov=normcoverage.txt normb=20 stats=stats.txt</pre></div><p><span>That will generate coverage per transcript, with 20 lines per transcript, each line showing the coverage for that fraction of the transcript. "stats" will contain other information like the fraction of bases in each transcript that was covered.&nbsp;</span></p><ul>
<li><strong>To calculate physical coverage stats (region covered by paired-end reads)&nbsp;</strong></li>
</ul><p><span>BBMap has a "physcov" flag that allows it to report physical rather than sequenced coverage. It can be used directly in BBMap, or with pileup, if you already have a sam file. For example:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ pileup.sh in=mapped.sam covstats=coverage.txt</pre></div><ul>
<li><strong>Calculating coverage of the genome</strong></li>
</ul><p><br /><span>Program will take sam or bam, sorted or unsorted.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ pileup.sh in=mapped.sam out=stats.txt hist=histogram.txt</pre></div><p><span>stats.txt will contain the average depth and percent covered of each reference sequence; the histogram will contain the exact number of bases with a each coverage level. You can also get per-base coverage or binned coverage if you want to plot the coverage. It also generates median and standard deviation, and so forth.</span><br /><br /><span>It's also possible to generate coverage directly from BBMap, without an intermediate sam file, like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbmap.sh in=reads.fq ref=reference.fasta nodisk covstats=stats.txt covhist=histogram.txt</pre></div><p><span>We use this a lot in situations where all you care about is coverage distributions, which is somewhat common in metagenome assemblies. It also supports most of the flags that pileup.sh supports, though the syntax is slightly different to prevent collisions. In each case you can see all the possible flags by running the shellscript with no arguments.</span></p><ul>
<li><strong>To bin aligned reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ pileup.sh in=mapped.sam out=stats.txt bincov=coverage.txt binsize=1000</pre></div><p><span>That will give coverage within each bin. For read density regardless of read length, add the "startcov=t" flag.&nbsp;&nbsp;</span><br /><br /><span>--------------------------------------------------------------</span><br /><strong>Dedupe.sh</strong><br /><br /><span>Dedupe ensures that there is at most one copy of any input sequence, optionally allowing contaminants (substrings) to be removed, and a variable hamming or edit distance to be specified. Usage:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ dedupe.sh in=assembly1.fa,assembly2.fa out=merged.fa</pre></div><p><span>That will absorb exact duplicates and containments. You can use "hdist" and "edist" flags to allow mismatches, or get a complete list of flags by running the shellscript with no arguments.&nbsp;&nbsp;</span><br /><br /><span>Dedupe&nbsp;</span><span style="text-decoration: underline;">will merge assemblies</span><span>, but it&nbsp;</span><span style="text-decoration: underline;">will not produce consensus sequences or join overlapping reads</span><span>; it only removes sequences that are fully contained within other sequences (allowing the specified number of mismatches or edits).</span><br /><br /><span>Dedupe can remove duplicate reads from multiple files simultaneously, if they are comma-delimited (e.g. in=file1.fastq,file2.fastq,file3.fastq). And if you set the flag "uniqueonly=t" then ALL copies of duplicate reads will be removed, as opposed to the default behavior of leaving one copy of duplicate reads.</span><br /><br /><span>However, it does not care which file a read came from; in other words, it can't remove only reads that are duplicates across multiple files but leave the ones that are duplicates within a file. That can still be accomplished, though, like this:</span><br /><br /><span>1) Run dedupe on each sample individually, so now there are at most 1 copy of a read per sample.</span><br /><span>2) Run dedupe again on all of the samples together, with "uniqueonly=t". The only remaining duplicate reads will be the ones duplicated between samples, so that's all that will be removed.&nbsp;&nbsp;</span><br /><br /><span>--------------------------------------------------------------</span></p><ul>
<li><strong>Generate ROC curves from any aligner</strong></li>
</ul><p><br /><strong>[*]index the reference<br /><br /></strong></p><div><div>Code:</div><pre dir="ltr">$ bbmap.sh ref=reference.fasta</pre></div><p><br /><strong>[*]Generate random reads</strong><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ randomreads.sh reads=100000 length=100 out=synth.fastq maxq=35 midq=25 minq=15</pre></div><p><strong>[*]Map to produce a sam file</strong><br /><br /><span>...substitute this command with the appropriate one from your aligner of choice</span></p><div><div>Code:</div><pre dir="ltr">$ bbmap.sh in=synth.fq out=mapped.sam</pre></div><p><strong>[*]Generate ROC curve</strong><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ samtoroc.sh in=mapped.sam reads=100000</pre></div><p><span>--------------------------------------------------------------</span></p><ul>
<li><strong>Calculate heterozygous rate for sequence data</strong></li>
</ul><p><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ kmercountexact.sh in=reads.fq khist=histogram.txt peaks=peaks.txt</pre></div><p><span>You can examine the histogram manually, or use the "peaks" file which tells you the number of unique kmers in each peak on the histogram. For a diploid, the first peak will be the het peak, the second will be the homozygous peak, and the rest will be repeat peaks. The peak caller is not perfect, though, so particularly with noisy data I would only rely on it for the first two peaks, and try to quantify the higher-order peaks manually if you need to (which you generally don't).</span><br /><br /><span>-----------------------------------------------------------------</span></p><ul>
<li><strong>Compare mapped reads between two files</strong></li>
</ul><p><br /><span>To see how many mapped reads (can be mapped concordant or discordant, doesn't matter) are shared between the two alignment files and how many mapped reads are unique to one file or the other.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=file1.sam out=mapped1.sam mappedonly
$ reformat.sh in=file2.sam out=mapped2.sam mappedonly</pre></div><p><span>That gets you the mapped reads only. Then:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ filterbyname.sh in=mapped1.sam names=mapped2.sam out=shared.sam include=t</pre></div><p><span>...which gets you the set intersection;</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ filterbyname.sh in=mapped1.sam names=mapped2.sam out=only1.sam include=f
$ filterbyname.sh in=mapped2.sam names=mapped1.sam out=only2.sam include=f</pre></div><p><span>...which get you the set subtractions.&nbsp;&nbsp;</span><br /><br /><span>--------------------------------------------------------------</span><br /><br /><strong>BBrename.sh</strong></p><div><div>Code:</div><pre dir="ltr">$ bbrename.sh in=old.fasta out=new.fasta</pre></div><p><span>That will rename the reads as 1, 2, 3, 4, ... 222.</span><br /><br /><span>You can also give a custom prefix if you want. The input has to be text format, not .doc.&nbsp;&nbsp;</span><br /><br /><span>---------------------------------------------------------------------</span><br /><br /><strong>BBfakereads.sh</strong></p><ul>
<li><strong>Generating &ldquo;fake&rdquo; paired end reads from a single end read file</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ bfakereads.sh in=reads.fastq out1=r1.fastq out2=r2.fastq length=100</pre></div><p><span>That will generate fake pairs from the input file, with whatever length you want (maximum of input read length). We use it in some cases for generating a fake LMP library for scaffolding from a set of contigs. Read 1 will be from the left end, and read 2 will be reverse-complemented and from the right end; both will retain the correct original qualities. And " /1" " /2" will be suffixed after the read name.&nbsp;&nbsp;</span><br /><br /><span>------------------------------------------------------------------</span><br /><strong>Randomreads.sh</strong></p><ul>
<li><strong>Generate random reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ randomreads.sh ref=genome.fasta out=reads.fq len=100 reads=10000</pre></div><p><span>"seed=-1" will use a random seed; any other value will use that specific number as the seed</span><br /><br /><span>You can specify paired reads, an insert size distribution, read lengths (or length ranges), and so forth. But because I developed it to benchmark mapping algorithms, it is specifically designed to give excellent control over mutations. You can specify the number of snps, insertions, deletions, and Ns per read, either exactly or probabilistically; the lengths of these events is individually customizable, the quality values can alternately be set to allow errors to be generated on the basis of quality; there's a PacBio error model; and all of the reads are annotated with their genomic origin, so you will know the correct answer when mapping.</span><br /><br /><span>--------------------------------------------------------------------</span></p><ul>
<li><strong>Generate saturation curves to assess sequencing depth</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ bbcountunique.sh in=reads.fq out=histogram.txt</pre></div><p><span>It works by pulling kmers from each input read, and testing whether it has been seen before, then storing it in a table.</span><br /><br /><span>The bottom line, "first", tracks whether the first kmer of the read has been seen before (independent of whether it is read 1 or read 2).</span><br /><br /><span>The top line, "pair", indicates whether a combined kmer from both read 1 and read 2 has been seen before. The other lines are generally safe to ignore but they track other things, like read1- or read2-specific data, and random kmers versus the first kmer.</span><br /><br /><span>It plots a point every X reads (configurable, default 25000).</span><br /><br /><span>In noncumulative mode (default), a point indicates "for the last X reads, this percentage had never been seen before". In this mode, once the line hits zero, sequencing more is not useful.</span><br /><br /><span>In cumulative mode, a point indicates "for all reads, this percentage had never been seen before", but still only one point is plotted per X reads.</span><br /><br /><span>-----------------------------------------------------------------</span><br /><strong>CalcTrueQuality.sh</strong><br /><br /><a href="http://seqanswers.com/forums/showthread.php?p=170904" target="_blank">http://seqanswers.com/forums/showthread.php?p=170904</a><br /><br /><span>In light of the quality-score issues with the NextSeq platform, and the possibility of future Illumina platforms (HiSeq 3000 and 4000) also using quantized quality scores, I developed it for recalibrating the scores to ensure accuracy and restore the full range of values.</span><br /><br /><span>-----------------------------------------------------------------</span><br /><br /><strong>BBMapskimmer.sh</strong><br /><br /><span>BBMap is designed to find the best mapping, and heuristics will cause it to ignore mappings that are valid but substantially worse. Therefore, I made a different version of it, BBMapSkimmer, which is designed to find all of the mappings above a certain threshold. The shellscript is bbmapskimmer.sh and the usage is similar to bbmap.sh or mapPacBio.sh. For primers, which I assume will be short, you may wish to use a lower than default K of, say, 10 or 11, and add the "slow" flag.</span><br /><br /><span>--------------------------------------------------------------</span><br /><br /><strong>msa.sh and curprimers.sh</strong><br /><br /><span>Quoted from Brian's response directly.</span><br /><br /><span>I also wrote another pair of programs specifically for working with primer pairs, msa.sh and cutprimers.sh. msa.sh will forcibly align a primer sequence (or a set of primer sequences) against a set of reference sequences to find the single best matching location per reference sequence - in other words, if you have 3 primers and 100 ref sequences, it will output a sam file with exactly 100 alignments - one per ref sequence, using the primer sequence that matched best. Of course you can also just run it with 1 primer sequence.</span><br /><br /><span>So you run msa twice - once for the left primer, and once for the right primer - and generate 2 sam files. Then you feed those into cutprimers.sh, which will create a new fasta file containing the sequence between the primers, for each reference sequence. We used these programs to synthetically cut V4 out of full-length 16S sequences.</span><br /><br /><span>I should say, though, that the primer sites identified are based on the normal BBMap scoring, which is not necessarily the same as where the primers would bind naturally, though with highly conserved regions there should be no difference.</span><br /><br /><span>------------------------------------------------------</span><br /><strong>testformat.sh</strong><br /><br /><strong>Identify type of Q-score encoding in sequence files</strong><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ testformat.sh in=seq.fq.gz
sanger    fastq    gz    interleaved    150bp</pre></div><p><span>--------------------------------------------------</span><br /><strong>kcompress.sh</strong><br /><br /><span>Newest member of BBTools. Identify constituent k-mers.&nbsp;</span><br /><a href="http://seqanswers.com/forums/showthread.php?t=63258" target="_blank">http://seqanswers.com/forums/showthread.php?t=63258</a><br /><br /><span>----------------------------------------------------</span><br /><strong>commonkmers.sh</strong><br /><br /><span>Find all k-mers for a given sequence.</span></p><div><div>Code:</div><pre dir="ltr">$ commonkmers.sh in=reads.fq out=kmers.txt k=4 count=t display=999</pre></div><p><span>Will produce output that looks like</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">MISEQ05:239:000000000-A74HF:1:2110:14788:23085	ATGA=8	ATGC=6	GTCA=6	AAAT=5	AAGC=5	AATG=5	AGCA=5	ATAA=5	ATTA=5	CAAA=5	CATA=5	CATC=5	CTGC=5	AACC=4	AACG=4	AAGA=4	ACAT=4	ACCA=4	AGAA=4	ATCA=4	ATGG=4	CAAG=4	CCAA=4	CCTC=4	CTCA=4	CTGA=4	CTTC=4	GAGC=4	GGTA=4	GTAA=4	GTTA=4	AAAA=3	AAAC=3	AAGT=3	ACCG=3	ACGG=3	ACTG=3	AGAT=3	AGCT=3	AGGA=3	AGTA=3	AGTC=3	CAGC=3	CATG=3	CGAG=3	CGGA=3	CGTC=3	CTAA=3	CTCC=3	CTTA=3	GAAA=3	GACA=3	GACC=3	GAGA=3	GCAA=3	GGAC=3	TCAA=3	TGCA=3	AAAG=2	AACA=2	AATA=2	AATC=2	ACAA=2	ACCC=2	ACCT=2	ACGA=2	ACGC=2	AGAC=2	AGCG=2	AGGC=2	CAAC=2	CAGG=2	CCGC=2	GCCA=2	GCTA=2	GGAA=2	GGCA=2	TAAA=2	TAGA=2	TCCA=2	TGAA=2	AAGG=1	AATT=1	ACGT=1	AGAG=1	AGCC=1	AGGG=1	ATAC=1	ATAG=1	ATTG=1	CACA=1	CACG=1	CAGA=1	CCAC=1	CCCA=1	CCGA=1	CCTA=1	CGAC=1	CGCA=1	CGCC=1	CGCG=1	CGTA=1	CTAC=1	GAAC=1	GCGA=1	GCGC=1	GTAC=1	GTGA=1	TTAA=1</pre></div><p><span>-----------------------------------------------------</span><br /><strong>Mutate.sh</strong><br /><br /><span>Simulate multiple mutants from a known reference (e.g.&nbsp;</span><em>E. coli</em><span>).</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ mutate.sh in=e_coli.fasta out=mutant.fasta id=99 
$ randomreads.sh ref=mutant.fasta out=reads.fq.gz reads=5m length=150 paired adderrors</pre></div><p><span>That will create a mutant version of E.coli with 99% identity to the original, and then generate 5 million simulated read pairs from the new genome. You can repeat this multiple times; each mutant will be different.</span><br /><br /><span>------------------------------------</span><br /><br /><strong>Partition.sh</strong><br /><br /><span>One can partition a large dataset with partition.sh into smaller subsets (example below splits data into 8 chunks).</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">partition.sh in=r1.fq in2=r2.fq out=r1_part%.fq out2=r2_part%.fq ways=8</pre></div><p><span>-----------------------------------</span><br /><strong>clumpify.sh</strong><br /><br /><span>If you are concerned about file size and want the files to be as small as possible, give Clumpify a try. It can reduce filesize by around 30% losslessly by reordering the reads. I've found that this also typically accelerates subsequent analysis pipelines by a similar factor (up to 30%). Usage:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">clumpify.sh in=reads.fastq.gz out=clumped.fastq.gz</pre></div><div><div>Code:</div><pre dir="ltr">clumpify.sh in1=reads_R1.fastq.gz in2=reads_R2.fastq.gz out1=clumped_R1.fastq.gz out2=clumped_R2.fastq.gz</pre></div><ul>
<li><strong>Clumpify.sh can now mark/remove sequence duplicates (optical/PCR/otherwise) from NGS data</strong></li>
</ul><p><br /><span>This does NOT require alignments so it should prove more useful compared to Picard MarkDuplicates. Relevant options for clumpify.sh command are listed below.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">dedupe=f optical=f (default)
Nothing happens with regards to duplicates.

dedupe=t optical=f
All duplicates are detected, whether optical or not.  All copies except one are removed for each duplicate.

dedupe=f optical=t
Nothing happens.

dedupe=t optical=t

Only optical duplicates (those with an X or Y coordinate within dist) are detected.  All copies except one are removed for each duplicate.
The allduplicates flag makes all copies of duplicates removed, rather than leaving a single copy.  But like optical, it has no effect unless dedupe=t.

Note: If you set "dupedist" to anything greater than 0, "optical" gets enabled automatically.</pre></div><p><span>-------------------------------------</span><br /><strong>fuse.sh</strong><br /><br /><span>Fuse will automatically reverse-complement read 2. Pad (N) amount can be adjusted as necessary. This will for example create a full size amplicon that can be used for alignments.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">fuse.sh in1=r1.fq in2=r2.fq pad=130 out=fused.fq fusepairs</pre></div>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8174/the-2014-cemm-phd-program</guid>
  <pubDate>Wed, 05 Feb 2014 06:03:15 -0600</pubDate>
  <link></link>
  <title><![CDATA[The 2014 CeMM PhD Program]]></title>
  <description><![CDATA[
<p>For our next PhD Program starting in October 2014 we are looking for exceptionally motivated PhD candidates with a keen interest in genomics and medicine and a strong interest to work in teams.</p>

<p>The 2014 CeMM PhD Program will focus on two thematic areas: INFECTION and CANCER, that are built on the pillars of epigenetics, bioinformatics and systems biology, chemical biology and the mechanism of action of drugs, high-throughput genetics, genomics and proteomics, and molecular and cell biology.</p>

<p>The choice of this strategic focus rests on the synergies between immunology, infection and cancer in pathophysiological and technological terms. It furthermore reflects the strength of the current CeMM faculty, itself built around the historical and contemporary expertise in immunology and cancer of the Medical University of Vienna.</p>

<p>As a CeMM PhD student you will get the chance to work at the cutting edge of interdisciplinary molecular medicine research and be trained by the entire CeMM and associated faculty to become one of the scientists shaping the future of molecular medicine.<br />Requirements</p>

<p>To be eligible to enroll in the CeMM PhD Program all candidates are required to have a bachelor’s or master’s degree in medicine, biology, chemistry, bioinformatics, mathematics or any scientific/technical, subject-relevant degree. Candidates do not need to have completed their degree at the time of application, however they must have obtained their final degree certificate by mid-September. The working language at CeMM is English, so excellent written and oral communication skills in English are required.<br />Timeline</p>

<p>    Applications open on 20th January and close on 20th March 2014.<br />    Two references are required to be submitted through the online system by 31st March 2014.<br />    All complete candidate applications are reviewed by the CeMM Faculty in early April.<br />    Selected candidates are invited to a Skype panel interview in late April.<br />    Shortlisted candidates are then invited to Vienna in May for a full interview process, including an opportunity to introduce yourself through a presentation and interview rounds, meet research group members, and attend an informal dinner to get to know the Faculty members and learn more about their research.<br />    Positions are offered by CeMM Faculty in June.<br />    Start of PhD Program: 1st October 2014 .</p>

<p>Contact</p>

<p>Binia Maria Günther, BEd BA<br />Human Resources Manager<br />bguenther@cemm.oeaw.ac.at</p>

<p>Catherine Lloyd, Ph.D.<br />PhD and Postdoc Program Manager<br />clloyd@cemm.oeaw.ac.at</p>

<p>More Info: www.cemm.oeaw.ac.at/phd-program/application/</p>
]]></description>
</item>

</channel>
</rss>