BOL: Related items

MUMmer4: A fast and versatile genome alignment system

Jit — Sat, 03 Feb 2018 04:59:17 -0600

MUMmer4, a substantially improved version of MUMmer that addresses genome size constraints by changing the 32-bit suffix tree data structure at the core of MUMmer to a 48-bit suffix array, and that offers improved speed through parallel processing of input query sequences. With a theoretical limit on the input size of 141Tbp, MUMmer4 can now work with input sequences of any biologically realistic length. We show that as a result of these enhancements, the nucmer program in MUMmer4 is easily able to handle alignments of large genomes;

Address of the bookmark: https://mummer4.github.io/

Project Fellow @ Alagappa University

Sat, 07 Sep 2013 14:24:13 -0500

Advertisement for the post of project Fellow in UGC project

Project Fellow – One Post

Duration: Three Years

Fellowship : Rs.14, 000/- per month + HRA

Walk-in-interview: 16th Sept, 2013 at 10.00 am

Venue : Department of Bioinformatics, Alagappa University

Eligible candidates can attend walk in interview for the post of Project Fellow in UGC supported project entitled “Shape and chemical feature based 3D- Pharmacophore Model generation, Virtual Screening and MESP studies to identify Potential Leads for Antifungal Azoles”

Interested candidates may apply to Dr. Sanjeev Kumar Singh, Principal Investigator, Department of Bioinformatics, Karaikudi with their Curriculum Vitae along with the copies of the certificates in proof of their educational qualification and experience at skysanjeev@gmail.com

Qualification:

PG Degree in Bioinformatics / Chemistry/ Molecular Biology/ Biotechnology / Biophysics / Biochemistry / Life Sciences/ Pharmacy with minimum of 55% marks in the PG examinations

Desirable:

Research experience in Molecular modeling and CADD will be given preference. UGC-NET/ CSIR-JRF qualified candidates will get preference.

The posts are purely on temporary basis. No TA/DA will be paid for attending the interview.

Advertisement: http://www.alagappauniversity.ac.in/files/news_files/new%20advt-UGC-16sept,13.doc

Metassembler: merging and optimizing de novo genome assemblies

Rahul Nayak — Tue, 08 May 2018 04:52:33 -0500

Metassembler combines multiple whole genome de novo assemblies into a combined consensus assembly using the best segments of the individual assemblies.

Genome assembly projects typically run multiple algorithms in an attempt to find the single best assembly, although those assemblies often have complementary, if untapped, strengths and weaknesses. We present our metassembler algorithm that merges multiple assemblies of a genome into a single superior sequence.

Address of the bookmark: https://sourceforge.net/projects/metassembler/?source=directory

PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.

Surabhi Chaudhary — Mon, 11 Jun 2018 03:08:26 -0500

We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler. http://derisilab.ucsf.edu/software/price/

Address of the bookmark: http://derisilab.ucsf.edu/software/price/

Mathivanan Lab

Fri, 20 Sep 2013 13:09:38 -0500

The major research interests are in exploring the role of extracellular matrix components (soluble secreted proteins and membrane vesicles) in cancer and intercellular communication. The lab integrates proteomic, genomic and bioinformatics methodologies to explore cancer cells.

More at http://www.mathivananlab.org/index.html

http://scholar.google.com/citations?user=U6PyEdYAAAAJ&hl=en

LINKS scaffolder bloomfilter setting !

Jit — Fri, 15 Jun 2018 10:39:54 -0500

➜ bin git:(master) ✗ ls -l
total 68
drwxrwxr-x 3 urbe urbe 4096 Jun 15 12:15 lib
-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS
➜ bin git:(master) ✗ pwd
/home/urbe/Tools/LINKS_1.8.6/bin

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Junior Research Fellow @ IIT

Sat, 21 Sep 2013 18:04:50 -0500

Applications are invited from the citizens of India for filling up the following temporary position for the sponsored project undertaken in the Department of Biosciences and Bioengineering of this Institute. The position is temporary initially for a period of 1 Year and tenable only for the duration of the project. The requisite qualification & experience etc. are given below:

Project Code, Project Title & Funding Agency
13DST016 : "Studies on the component of mimivirus DNA replication machinery" (Department of Science & Technology)

Position & Salary
Junior Research Fellow (1 Post )
Consolidated salary
Rs.16000/- p.m. + HRA
Qualification
MSc or MTech or BTech or BE in one of the following branches with first class-Biochemistry, Microbiology, genetic Engineering, Biotechnology, Medical Microbiology, Bioinformatics, life sciences etc.
Job Profile
Project involves virus culturing and purification, cloning, protein purification and measurement of helicase, primase, nuclease, translocase activities using various methods. Person should be highly motivated and some experience in cloning and protein purification is desirable. Experience in handling insect cell lines will be an added advantage.

More at http://www.ircc.iitb.ac.in/IRCC-Webpage/rnd/RecruitmentGenerateCircular.jsp?srno=2013086

GFinisher: a new strategy to refine and finish bacterial genome assemblies

Jit — Thu, 26 Jul 2018 09:31:55 -0500

GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.

java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory

Address of the bookmark: http://gfinisher.sourceforge.net

3 days intensive course on Understanding 'omics data in Basel, Switzerland, 19-21st November

Mon, 23 Sep 2013 10:46:57 -0500

Benefits for the participants

- Plan more efficient experiments
- Correctly interpret results
- Communicate results in publications more effectively

The course focus is on methodologies, not on particular software tools. After the course participants should be able to apply the methods in their respective environment. However, during the course, hands-on sessions will be performed using the Genedata Expressionist® software, which enables participants to quickly apply the discussed methods and visualize results. No previous knowledge on Expressionist® is required; access to the software is free of charge during the course.

More @ http://www.dixa-fp7.eu/dixa-training/dixa-training-agenda/genedata-academy#!

MITOS: improved de novo metazoan mitochondrial genome annotation

Jit — Fri, 26 Oct 2018 08:25:39 -0500

Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.

Address of the bookmark: http://mitos.bioinf.uni-leipzig.de/index.py