<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30093?offset=510</link>
	<atom:link href="https://bioinformaticsonline.com/related/30093?offset=510" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4706/junior-research-fellow-iit</guid>
  <pubDate>Sat, 21 Sep 2013 18:04:50 -0500</pubDate>
  <link></link>
  <title><![CDATA[Junior Research Fellow @ IIT]]></title>
  <description><![CDATA[
<p>Applications are invited from the citizens of India for filling up the following temporary position for the sponsored project undertaken in the Department of Biosciences and Bioengineering of this Institute. The position is temporary initially for a period of  1 Year  and tenable only for the duration of the project. The requisite qualification &amp; experience etc. are given below:<br /> <br />Project Code, Project Title &amp; Funding Agency<br />13DST016 : "Studies on the component of mimivirus DNA replication machinery" (Department of Science &amp; Technology)<br /> <br />Position &amp; Salary	<br />Junior Research Fellow (1 Post )<br />Consolidated salary <br /> Rs.16000/- p.m. + HRA<br />Qualification	<br />MSc or MTech or BTech or BE in one of the following branches with first class-Biochemistry, Microbiology, genetic Engineering, Biotechnology, Medical Microbiology, Bioinformatics, life sciences etc.<br />Job Profile	<br />Project involves virus culturing and purification, cloning, protein purification and measurement of helicase, primase, nuclease, translocase activities using various methods. Person should be highly motivated and some experience in cloning and protein purification is desirable. Experience in handling insect cell lines will be an added advantage.</p>

<p>More at http://www.ircc.iitb.ac.in/IRCC-Webpage/rnd/RecruitmentGenerateCircular.jsp?srno=2013086</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4728/3-days-intensive-course-on-understanding-omics-data-in-basel-switzerland-19-21st-november</guid>
  <pubDate>Mon, 23 Sep 2013 10:46:57 -0500</pubDate>
  <link></link>
  <title><![CDATA[3 days intensive course on Understanding 'omics data in Basel, Switzerland, 19-21st November]]></title>
  <description><![CDATA[
<p>Benefits for the participants</p>

<p>- Plan more efficient experiments<br />- Correctly interpret results<br />- Communicate results in publications more effectively</p>

<p>The course focus is on methodologies, not on particular software tools. After the course participants should be able to apply the methods in their respective environment. However, during the course, hands-on sessions will be performed using the Genedata Expressionist® software, which enables participants to quickly apply the discussed methods and visualize results. No previous knowledge on Expressionist® is required; access to the software is free of charge during the course.</p>

<p>More @ http://www.dixa-fp7.eu/dixa-training/dixa-training-agenda/genedata-academy#!</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</guid>
	<pubDate>Fri, 26 Oct 2018 08:25:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</link>
	<title><![CDATA[MITOS: improved de novo metazoan mitochondrial genome annotation]]></title>
	<description><![CDATA[<p><span>Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.</span></p><p>Address of the bookmark: <a href="http://mitos.bioinf.uni-leipzig.de/index.py" rel="nofollow">http://mitos.bioinf.uni-leipzig.de/index.py</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/5209/anders-krogh-lab</guid>
  <pubDate>Mon, 30 Sep 2013 19:07:40 -0500</pubDate>
  <link></link>
  <title><![CDATA[Anders Krogh Lab]]></title>
  <description><![CDATA[
<p>In a lot of my work in bioinformatics, I have been using hidden Markov models (HMMs). As a postdoc with David Haussler at UCSC we developed the so-called profile HMMs (refs). Since then I have applied HMMs to membrane proteins (refs) and gene identification (refs) and have worked on methods for such things as discriminative estimation of HMMs (refs) and alternative decoding algorithms etc. (refs).</p>

<p>Now my main interests are in gene regulation, where we work on promoter analysis; non-coding RNA, where miRNAs and structure prediction are the main areas; and protein structure, where the group is working on methods for structure prediction from sequence. To read more about these topics, please see the research pages. </p>

<p>Lab page @ http://wiki.binf.ku.dk/User:Krogh</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</guid>
	<pubDate>Fri, 09 Nov 2018 13:50:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</link>
	<title><![CDATA[ASCIIGenome: genome browser based on command line interface and designed for running from console terminals.]]></title>
	<description><![CDATA[<p><code>ASCIIGenome</code>&nbsp;is a genome browser based on command line interface and designed for running from console terminals.</p>
<p>Since&nbsp;<code>ASCIIGenome</code>&nbsp;does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like&nbsp;<a href="https://www.broadinstitute.org/igv/">IGV</a>.</p>
<p><span>Documentation</span>&nbsp;is at&nbsp;<a href="http://asciigenome.readthedocs.io/en/latest/">readthedocs/asciigenome</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/dariober/ASCIIGenome" rel="nofollow">https://github.com/dariober/ASCIIGenome</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4946/crcri-bioinfomatics-walk-in-on-08102013</guid>
  <pubDate>Fri, 27 Sep 2013 10:59:53 -0500</pubDate>
  <link></link>
  <title><![CDATA[CRCRI Bioinfomatics Walk In on 08.10.2013]]></title>
  <description><![CDATA[
<p>Walk-in-Interview for recruitment of one Project Fellow for a period of 10 months purely on temporary basis is proposed to be held at Central Tuber Crops Research Institute, Sreekariyam, Thiruvananthapuram for a KSCSTE funded project entitled “PARTICIPATORY DEVELOPMENT OF A WEB BASED USER FRIENDLY CASSAVA EXPERT SYSTEM”</p>

<p>Salary: Rs. 10,000/- per month.</p>

<p>Age limit: 35 for men and 40 for women &amp; SC/ST.</p>

<p>Qualification: First class in M. Sc (Agriculture)/MCA/M.Sc (IT)/ M. Sc (Computer Application)/M.Sc (Bioinformatics)/M.Sc (Geoinformatics).</p>

<p>Desirable: Two years experience in web design and web programming.</p>

<p>Date &amp; time of interview: 08.10.2013, 10 am</p>

<p>Interested candidates may appear for an interview at this institute along with their application in plain paper containing the following particulars viz. (1) Name (2) Father/Husband/Guardian’s Name (3) date of birth &amp; age as on 01.10.2013 (4) Permanent address (5) Address for communication (6) Email address and Telephone No. with code (7) Qualification (8) National fellowship like ICAR/CSIR/UGC etc. if any (9) Whether SC/ST/OBC (10) Details of experience (Attested copies of degree certificate, proof of age, mark sheets). Original certificates should be produced for verification.</p>

<p>No TA/DA will be admissible to the candidates attending the test. The selected candidate will have to join immediately.</p>

<p>Advertisement: http://www.ctcri.org/careers/mithra_SRF.doc</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</guid>
	<pubDate>Wed, 12 Dec 2018 08:33:41 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</link>
	<title><![CDATA[genoPlotR - plot gene and genome maps project!]]></title>
	<description><![CDATA[<p>genoPlotR is a R package to produce reproducible, publication-grade graphics of gene and genome maps. It allows the user to read from usual format such as protein table files and blast results, as well as home-made tabular files.</p>
<h3>Features</h3>
<ul>
<li>Linear representation of several segments of DNA</li>
<li>Comparisons represented by areas between the segments (like Artemis, for example)</li>
<li>Reads from common formats: Genbank, EMBL, blast, Mauve, and from user-generated tab files</li>
<li>Plot several subsegments of the same segment on the same line, separated by a //</li>
<li>Automatic or manual placement of the segments on the plot</li>
<li>Add annotations to all the lines</li>
<li>Create smart, automatic annotations for genomes, based on gene names</li>
<li>Add a user-generated tree</li>
<li>Add a global scale or a scale to each line</li>
<li>Use user-defined graphical functions to represent genes</li>
<li></li>
</ul><p>Address of the bookmark: <a href="http://genoplotr.r-forge.r-project.org/" rel="nofollow">http://genoplotr.r-forge.r-project.org/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/5187/bioinformatics-algorithms-part-1-with-pavel-pevzner-phillip-e-c-compeau</guid>
	<pubDate>Mon, 30 Sep 2013 11:34:09 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/5187/bioinformatics-algorithms-part-1-with-pavel-pevzner-phillip-e-c-compeau</link>
	<title><![CDATA[Bioinformatics Algorithms (Part 1)  with Pavel  Pevzner, Phillip E. C. Compeau,]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/t5t_nfzdzEg" frameborder="0" allowfullscreen></iframe><p>The course Bioinformatics Algorithms (Part 1) by Pavel Pevzner, Phillip E. C. Compeau, and Nikolay Vyahhi from University of California, San Diego will be offered free of charge to everyone on the Coursera platform. Sign up at http://www.coursera.org/course/bioinformatics.</p>]]></description>
	
</item>

</channel>
</rss>