<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30093?offset=550</link>
	<atom:link href="https://bioinformaticsonline.com/related/30093?offset=550" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35635/ete-3-reconstruction-analysis-and-visualization-of-phylogenomic-data</guid>
	<pubDate>Mon, 19 Feb 2018 06:46:15 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35635/ete-3-reconstruction-analysis-and-visualization-of-phylogenomic-data</link>
	<title><![CDATA[ETE 3: Reconstruction, Analysis, and Visualization of Phylogenomic Data]]></title>
	<description><![CDATA[<p><span>ETE v3, featuring numerous improvements in the underlying library of methods, and providing a novel set of standalone tools to perform common tasks in comparative genomics and phylogenetics. </span></p>
<p><span>The new features include </span></p>
<p><span>(i) building gene-based and supermatrix-based phylogenies using a single command, </span></p>
<p><span>(ii) testing and visualizing evolutionary models, </span></p>
<p><span>(iii) calculating distances between trees of different size or including duplications, and </span></p>
<p><span>(iv) providing seamless integration with the NCBI taxonomy database. </span></p>
<p><span>ETE is freely available at&nbsp;</span><a href="http://etetoolkit.org/" target="">http://etetoolkit.org</a></p><p>Address of the bookmark: <a href="http://etetoolkit.org" rel="nofollow">http://etetoolkit.org</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/28564/dbt-%E2%80%93-bioinformatics-industrial-training-programme-biitp-2016-%E2%80%93-17</guid>
	<pubDate>Wed, 27 Jul 2016 04:09:59 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/28564/dbt-%E2%80%93-bioinformatics-industrial-training-programme-biitp-2016-%E2%80%93-17</link>
	<title><![CDATA[DBT – Bioinformatics Industrial Training Programme (BIITP) 2016 – 17]]></title>
	<description><![CDATA[<p>BIITP is a programme of Department of Biotechnology (DBT), Ministry of Science and Technology, Government of India, managed by Biotech Consortium India Limited (BCIL).The objective of BIITP is to provide an opportunity to bioinformatics students to acquire practical skills and experience by working on projects alongside industry experts as well as to provide an opportunity for the industry to identify potential employees.</p><p><strong>DBT Invites online applications from the bioinformatics&nbsp;students and requisitions from biotech/bioinformatics companies.</strong></p><p><strong>Biotech Industry</strong>&nbsp;:</p><p>Biotech/Bioinformatics companies interested to provide hands on industrial training to the students of Bioinformatics under BIITP may apply online. The companies would have no obligation towards any payments to trainees. The companies would be paid bench fee to cover expenses towards training. Trainees would be provided to companies subject to availability.</p><p><strong>Attn: Bioinformatics Students</strong></p><p>Bioinformatics students interested in training in biotech / bioinformatics companies may apply online.&nbsp;<strong>Stipend of Rs. 10,000/- per month</strong>&nbsp;will be paid to candidates placed for training. The candidates will be selected for training through an interview.</p><p><strong>Eligiblity</strong>&nbsp;:</p><p>a) B.E /B.Tech./M.Sc./M.Tech./Advanced Post Graduate Diploma in Bioinformatics from an Indian recognized university with minimum 55% marks or equivalent grade at highest degree/diploma completed in the year 2015 or 2016 are only eligible to apply.</p><p>b) The Advanced Post Graduate diploma should be of at least one year duration after graduation.</p><p>c)&nbsp; Students whose result of last semester/final year is not declared can also apply mentioning their marks upto the semester/year upto which result declared. The final result with original mark sheet(s) of all the semesters/years will have to be produced at the time of interview.</p><p><strong>Application Procedure</strong>&nbsp;:</p><p>The online application form is available below :</p><p><strong><a href="https://www.biotecnika.org/2016/07/dbt-bioinformatics-industrial-training-programme-biitp-2016-17/?xurl=%3A%2F%2Fwww.bcil.nic.in%2Fbiitp2016-17%2Fregistration1.asp" target="_blank">Application Form For Students (New User)</a></strong></p><p><strong><a href="https://www.biotecnika.org/2016/07/dbt-bioinformatics-industrial-training-programme-biitp-2016-17/?xurl=%3A%2F%2Fwww.bcil.nic.in%2Fbiitp2016-17%2Fregistration.asp%3FT1%3DCompany" target="_blank">Requisition form for companies (New User)</a></strong></p><p><strong><a href="https://www.biotecnika.org/2016/07/dbt-bioinformatics-industrial-training-programme-biitp-2016-17/?xurl=%3A%2F%2Fwww.bcil.nic.in%2Fbiitp2016-17%2Findex1.asp" target="_blank">Already registered User Click Here</a></strong></p><p>The following documents are to be sent to Mr. Manoj Gupta, Manager, Biotech Consortium India Limited, 5th floor, Anuvrat Bhawan, 210, Deen Dayal UpadhyayaMarg, New Delhi-110002.</p><p>More at&nbsp;http://www.bcil.nic.in/biitp2016-17/index.asp</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/28592/bioinformatics-technical-position-at-cdac-pune-india</guid>
  <pubDate>Mon, 01 Aug 2016 03:36:26 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics Technical Position at CDAC Pune - India]]></title>
  <description><![CDATA[
<p>CDAC Pune Recruitment 2016 – Apply Online for Technical Positions: Department of Information Technology under the Ministry of Communications and Information Technology, Government of India, Centre for Development of Advanced Computing (C-DAC), Pune has advertised notification for the recruitment of Technical vacancies for for PwD candidates n direct recruitment basis. Eligible candidates can apply Online from 27-07-2016 at 10.00 AM to 31-08-2016 at 18.00 PM.. Other information like age limit, educational qualification, selection process &amp; how to apply are given below… </p>

<p>CDAC Pune Vacancy Details:<br />Total No. of Posts: 23 </p>

<p>Name of the Post: Technical </p>

<p>Name of the Discipline:<br />A. Computer Science/ Information Technology and Allied disciplines. </p>

<p>B.Electronics Communications/ Electrical/ Telecommunication/Instrumentation &amp; Control/ Medical Electronics/ Power Electronics/ VLSI &amp; Embedded System and Allied disciplines. </p>

<p>C.Biotechnology/ Bioinformatics/ Health informatics/ Geoinformatics/ Meteorology/ Environmental Science/ Ocean Sciences/Oceanography/Environmental Engineering </p>

<p>1. Visually Impaired: 09 Posts </p>

<p>2. Hearing Impaired: 08 Posts </p>

<p>3. Orthopedically Impaired: 06 Posts </p>

<p>Educational Qualification : Candidates should possess Graduation in relvany discpline with relevant experience. </p>

<p>Selection Process: Candidates will be selected based on applicants performance in interview. </p>

<p>How to Apply: Eligible candidates can apply online through the website www.cdac.in from 27-07-2016 at 10.00 AM to 31-08-2016 at 18.00 PM. </p>

<p>More at http://www.cdac.in/index.aspx?id=current_jobs</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39875/lrsday-long-read-sequencing-data-analysis-for-yeasts</guid>
	<pubDate>Mon, 26 Aug 2019 18:07:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39875/lrsday-long-read-sequencing-data-analysis-for-yeasts</link>
	<title><![CDATA[LRSDAY: Long-read Sequencing Data Analysis for Yeasts]]></title>
	<description><![CDATA[<p><span>Long-read sequencing technologies have become increasingly popular in genome projects due to their strengths in resolving complex genomic regions. As a leading model organism with small genome size and great biotechnological importance, the budding yeast,&nbsp;</span><em>Saccharomyces cerevisiae</em><span>, has many isolates currently being sequenced with long reads.&nbsp;</span></p><p>Address of the bookmark: <a href="https://github.com/yjx1217/LRSDAY" rel="nofollow">https://github.com/yjx1217/LRSDAY</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/42490/bioinformatics-scientist-%E2%80%93-icmr-computational-genomics-centre</guid>
  <pubDate>Sat, 26 Dec 2020 10:18:29 -0600</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics Scientist – ICMR Computational Genomics Centre]]></title>
  <description><![CDATA[
<p>ICMR invites online applications, from Indian Citizens, up to 8th January 2020 till 5:30 PM to fill up the following post to be filled purely on a temporary basis under “ICMR Computational Genomics Centre” under Dr. Harpreet Singh, Head, Division of Biomedical Informatics (BMI), ICMR HQRS, New Delhi 110029.<br />The Terms &amp; Conditions for the post are as follows:</p>

<p>a) Scientist-B – UR (2 posts-Bioinformatics) on consolidated salary of Rs.48,000/- pm + HRA</p>

<p>b) Scientist C – UR (1 post -Bioinformatics) on consolidated salary of Rs. 51,000 pm+ HRA</p>

<p>c) Scientist B- UR (2 post-Statistics) on a consolidated salary of Rs.48,000/- pm +HRA</p>

<p>d) Computer Programmer 1 post UR &amp; 1 post SC on a consolidated salary of Rs. 32,500/- pm</p>

<p>e) Research Assistant -UR 1 post on a consolidated salary of Rs. 31,000/- pm</p>

<p>More at https://projectjobs.icmr.org.in/sccbioinformatics/uploads/recruitment/Adv_BMI_24122020.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</guid>
	<pubDate>Sun, 20 Dec 2020 11:43:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</link>
	<title><![CDATA[BioJupies: Automatically Generates RNA-seq Data Analysis Notebooks]]></title>
	<description><![CDATA[<p>With BioJupies you can produce in seconds a customized, reusable, and interactive report from your own raw or processed RNA-seq data through a simple user interface</p>
<p>BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.</p><p>Address of the bookmark: <a href="https://amp.pharm.mssm.edu/biojupies/" rel="nofollow">https://amp.pharm.mssm.edu/biojupies/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/28851/senior-manager-bioinformatics-operations-at-rgcb-india</guid>
  <pubDate>Fri, 19 Aug 2016 04:37:17 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior Manager (Bioinformatics Operations) at RGCB, India]]></title>
  <description><![CDATA[
<p>Senior Manager (Bioinformatics Operations) <br />Rajiv Gandhi Centre for Biotechnology (RGCB) - Thiruvananthapuram, Kerala <br />₹15,600 - ₹39,100 a month<br />Rajiv Gandhi Centre for Biotechnology (RGCB) invites applications for the following positions from Indian citizens with prescribed qualifications </p>

<p>Senior Manager (Bioinformatics Operations) <br />No. of posts: 01 (General) <br />Pay Scale: PB-3 15600-39100 + Grade Pay Rs.6600/- <br />Min. Qualification: PhD in Bioinformatics, , Life Sciences or Computer Science applied to biological questions. <br />A Min. 5 years of experience <br />Age limit: 40 years as on August 01, 2016</p>

<p>More at http://www.rgcb.res.in/positions.php</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44470/phyloherb-phylogenomic-analysis-pipeline-for-herbarium-specimens</guid>
	<pubDate>Wed, 21 Feb 2024 06:15:13 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44470/phyloherb-phylogenomic-analysis-pipeline-for-herbarium-specimens</link>
	<title><![CDATA[PhyloHerb: Phylogenomic Analysis Pipeline for Herbarium Specimens]]></title>
	<description><![CDATA[<p><span>What is PhyloHerb</span><span>: PhyloHerb is a wrapper program to process&nbsp;</span><span>genome skimming</span><span>&nbsp;data collected from plant materials. The outcomes include the plastid genome (plastome) assemblies, mitochondrial genome assemblies, nuclear ribosomal DNAs (NTS+ETS+18S+ITS1+5.8S+ITS2+28S), alignments of gene and intergenic regions, and a species tree. It is designed to be a high throughput program dealing with lower quality data. Examples include&nbsp;</span><span>low-coverage (5x cpDNA) plastome phylogeny, recycling plastid genes from target enrichment data, retrieving low-copy nuclear genes from medium coverage (5x nucDNA) genome skimming</span><span>.</span></p><p>Address of the bookmark: <a href="https://github.com/lmcai/PhyloHerb/" rel="nofollow">https://github.com/lmcai/PhyloHerb/</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/29016/traineeshipstudentship-conducts-university-of-delhi-gargi-college</guid>
  <pubDate>Mon, 05 Sep 2016 03:45:58 -0500</pubDate>
  <link></link>
  <title><![CDATA[Traineeship/Studentship conducts University of Delhi (Gargi College)]]></title>
  <description><![CDATA[
<p>Traineeship/Studentship cunducts University of Delhi (Gargi College) on purely temporary for a period of six months.<br />Traineeship — 01 (one post)<br />Essential Qualification: Post Graduate degree in Bioinformatics or any other branch of Life Sciences preferably with dissertation in Bioinformatics. Desirable Qualification: Prior knowledge of programming languages such as C, VB, SQL etc. and software/database development<br />Studentship- 01 (one post)<br />Essential Qualifications: Final year Post Graduate students pursuing a degree in Bioinformatics or any branch of Life Science with knowledge of bioinformatics<br />Salary: Rs.8000/- p.m.<br />How to apply<br />Interested candidates are required to appear for the walk in interview on 14th. September, 2016 at 9.30 AM in Principal's Office, Gargi College, Sirifort Road, N. Delhi-110049</p>

<p>More at http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&amp;cntnt01articleid=12859&amp;cntnt01returnid=83</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>

</channel>
</rss>