<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30104?offset=1150</link>
	<atom:link href="https://bioinformaticsonline.com/related/30104?offset=1150" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44902/hite-a-fast-and-accurate-dynamic-boundary-adjustment-approach-for-full-length-transposable-elements-detection-and-annotation-in-genome-assemblies</guid>
	<pubDate>Sat, 20 Sep 2025 09:34:04 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44902/hite-a-fast-and-accurate-dynamic-boundary-adjustment-approach-for-full-length-transposable-elements-detection-and-annotation-in-genome-assemblies</link>
	<title><![CDATA[HiTE: a fast and accurate dynamic boundary adjustment approach for full-length Transposable Elements detection and annotation in Genome Assemblies]]></title>
	<description><![CDATA[<p dir="auto"><code>HiTE</code>&nbsp;is a Python software that uses a dynamic boundary adjustment approach to detect and annotate full-length Transposable Elements in Genome Assemblies. In comparison to other tools, HiTE demonstrates superior performance in detecting a greater number of full-length TEs.</p>
<div dir="auto">
<h2 dir="auto">panHiTE</h2>
<a href="https://github.com/CSU-KangHu/HiTE#panhite"></a></div>
<p dir="auto">We have developed panHiTE, a comprehensive and accurate pipeline for TE detection in large-scale population genomes. It has been successfully applied to hundreds of plant population genomes, demonstrating its effectiveness and scalability.</p>
<p dir="auto">For detailed instructions, please refer to the&nbsp;<a href="https://github.com/CSU-KangHu/HiTE/wiki/panHiTE-tutorial">panHiTE tutorial</a>.</p><p>Address of the bookmark: <a href="https://github.com/CSU-KangHu/HiTE" rel="nofollow">https://github.com/CSU-KangHu/HiTE</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/3868/next-generation-sequencing-ngs-tutorials</guid>
	<pubDate>Sat, 24 Aug 2013 06:01:37 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/3868/next-generation-sequencing-ngs-tutorials</link>
	<title><![CDATA[Next Generation Sequencing (NGS) Tutorials]]></title>
	<description><![CDATA[<p>Institute of computational biomedicine, Cornell University provide an NGS workshop tutorial at&nbsp;<a href="http://chagall.med.cornell.edu/NGScourse/">http://chagall.med.cornell.edu/NGScourse/</a>&nbsp;</p>
<p>You can also add your favourite NGS educational material, or workshop tutorial by commenting on this bookmarks for user benefit.&nbsp;</p>
<p>Understanding the basics of genome sequencing:</p>
<p>Tutorial by Luke Jostins.</p>
<p>http://www.genetic-inference.co.uk/blog/2009/04/basics-sequencing-dna-part-1/</p>
<p>http://www.genetic-inference.co.uk/blog/2009/08/basics-sequencing-dna-part-2/</p>
<p>A window into third-generation sequencing</p>
<p>http://hmg.oxfordjournals.org/content/19/R2/R227.full.pdf</p>
<p>==============================================</p>
<p>NGS data analysis pipelines</p>
<ul>
<li><strong>Detecting and annotating genetic variations using the HugeSeq pipeline</strong>&nbsp; DOI: <a href="http://dx.doi.org/10.1038/nbt.2134">10.1038/nbt.2134</a></li>
<li><strong> NARWHAL, a primary analysis pipeline for NGS data</strong> <a href="http://bioinformatics.oxfordjournals.org/cgi/content/abstract/28/2/284?etoc">http://bioinformatics.oxfordjournals.org/cgi/content/abstract/28/2/284?etoc</a></li>
<li><strong>RseqFlow: Workflows for RNA-Seq data analysis</strong>&nbsp; DOI: <a href="http://dx.doi.org/10.1093/bioinformatics/btr441">10.1093/bioinformatics/btr441</a></li>
<li><strong>ngs_backbone: a pipeline for read cleaning, mapping and SNP calling using Next Generation Sequence</strong>&nbsp;&nbsp;<a href="http://dx.doi.org/10.1186/1471-2164-12-285">10.1186/1471-2164-12-285</a></li>
<li><strong>A framework for variation discovery and genotyping using next-generation DNA sequencing data</strong>&nbsp; PubMed: <a href="http://www.ncbi.nlm.nih.gov/pubmed/21478889">21478889</a></li>
<li><strong>SNiPlay: a web-based tool for detection, management and analysis of SNPs. Application to grapevine diversity projects</strong>&nbsp; DOI: <a href="http://dx.doi.org/10.1186/1471-2105-12-134">10.1186/1471-2105-12-134</a> Abstract: <a href="http://www.biomedcentral.com/1471-2105/12/134/abstract">http://www.biomedcentral.com/1471-2105/12/134/abstract</a></li>
<li><strong>WEP: a high-performance analysis pipeline for whole-exome data&nbsp;</strong>http://www.biomedcentral.com/1471-2105/14/S7/S11</li>
<li><strong>DDBJ read annotation pipeline: a cloud computing-based pipeline for high-throughput analysis of next-generation sequencing data.&nbsp;</strong>http://www.ncbi.nlm.nih.gov/pubmed/23657089</li>
<li><strong>GATK: a Toolkit for Genome Analysis&nbsp;</strong>http://www.broadinstitute.org/gatk/</li>
<li><strong>Metagenomics</strong>:http://www.nbic.nl/education/nbic-phd-school/course-schedule/ngsmetagenomics/</li>
<li><strong>RNASeq</strong>:http://www.nbic.nl/education/nbic-phd-school/course-schedule/ngsrnaseq/</li>
<li><strong>Bioinformatics and Seq courses</strong>:&nbsp;http://www.isb-sib.ch/training/training-activities-schedule/archive-2013.html</li>
<li><strong>Variant Detection (Model organism) Advanced tutorial</strong> https://docs.google.com/document/pub?id=1CuKkKylVDb03tnN7RSWl5EUzleetn0ctjmvaidPKLxM</li>
<li><strong>Variant Detection Introductory tutorial</strong> https://docs.google.com/document/pub?id=1ZRzrjjOCvtAu3m-IKL-rbJ1f4On60dDL_IEwG7oejdI</li>
<li><strong>Microbial de novo Assembly for Illumina Data Introductory tutorial</strong> https://docs.google.com/document/pub?id=1N3AB9ptISUu4zULqe1kXpVF0BDyGb5f5yzxWSJd_WNM</li>
<li><strong>RNAseq Differential Gene Expression Introductory tutorial</strong> https://docs.google.com/document/pub?id=1KbTiBHtvHLfPRZ39AY3uriazrINA8TJzgjjwn1zPP7Y</li>
</ul>
<blockquote>
<p>" Please add your favourite NGS link below in comment section for the benefit of bioinformatics community ".&nbsp;</p>
</blockquote><p>Address of the bookmark: <a href="http://chagall.med.cornell.edu/NGScourse/" rel="nofollow">http://chagall.med.cornell.edu/NGScourse/</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22416/rosenberg-lab</guid>
  <pubDate>Wed, 27 May 2015 17:52:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Rosenberg lab]]></title>
  <description><![CDATA[
<p>Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:</p>

<p>    Human genetic variation<br />    Inference of human evolutionary history from genetic markers<br />    Statistical analysis of population-genetic data<br />    Mathematical models of gene genealogies<br />    Theoretical population genetics<br />    Combinatorics of evolutionary trees<br />    The relationship between gene trees and species trees<br />    The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility <br />More at https://web.stanford.edu/group/rosenberglab/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/23174/scaffolding-of-a-bacterial-genome-using-minion-nanopore-sequencing</guid>
	<pubDate>Tue, 07 Jul 2015 16:59:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/23174/scaffolding-of-a-bacterial-genome-using-minion-nanopore-sequencing</link>
	<title><![CDATA[Scaffolding of a bacterial genome using MinION nanopore sequencing]]></title>
	<description><![CDATA[<p><span>Second generation sequencing has revolutionized genomic studies. However, most genomes contain repeated DNA elements that are longer than the read lengths achievable with typical sequencers, so the genomic order of several generated contigs cannot be easily resolved. A new generation of sequencers offering substantially longer reads is emerging, notably the Pacific Biosciences (PacBio) RS II system and the MinION system, released in early 2014 by Oxford Nanopore Technologies through an early access program.</span></p><p>Address of the bookmark: <a href="http://www.nature.com/srep/2015/150707/srep11996/full/srep11996.html" rel="nofollow">http://www.nature.com/srep/2015/150707/srep11996/full/srep11996.html</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22437/jrf-bioinformatics-icar-national-research-centre-for-orchids-pakyong</guid>
  <pubDate>Thu, 28 May 2015 19:33:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF Bioinformatics @ ICAR - National Research Centre for Orchids  Pakyong]]></title>
  <description><![CDATA[
<p>ICAR - National Research Centre for Orchids</p>

<p>Pakyong</p>

<p>F.No:NRCO/Admn/DBT /136 /</p>

<p>Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.</p>

<p>‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”</p>

<p>Junior Research Fellow (One post)</p>

<p>Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.</p>

<p>Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques</p>

<p>2nd June 2015</p>

<p>Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/32862/gam-ngs-genomic-assemblies-merger-for-next-generation-sequencing</guid>
	<pubDate>Fri, 19 May 2017 07:44:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/32862/gam-ngs-genomic-assemblies-merger-for-next-generation-sequencing</link>
	<title><![CDATA[GAM-NGS: genomic assemblies merger for next generation sequencing]]></title>
	<description><![CDATA[<p><span>GAM-NGS is a tool able to merge two or more assemblies in order to improve contiguity and correctness. It can be used on all NGS-based assembly projects and it shows its full potential with multi-library Illumina-based projects. With more than 20 available assemblers it is hard to select the best tool. In this context we propose a tool that improves assemblies (and, as a by-product, perhaps even assemblers) by merging them and selecting the generating that is most likely to be correct.</span></p><p>Address of the bookmark: <a href="https://github.com/vice87/gam-ngs" rel="nofollow">https://github.com/vice87/gam-ngs</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33506/bedops-v2426-high-performance-genomic-feature-operations</guid>
	<pubDate>Mon, 12 Jun 2017 10:11:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33506/bedops-v2426-high-performance-genomic-feature-operations</link>
	<title><![CDATA[BEDOPS v2.4.26: high-performance genomic feature operations]]></title>
	<description><![CDATA[<p><strong>BEDOPS v2.4.26</strong> is a suite of tools to address common questions raised in genomic studies &mdash; mostly with regard to overlap and proximity relationships between data sets. It aims to be scalable and flexible, facilitating the efficient and accurate analysis and management of large-scale genomic data.</p>
<p>The <a href="https://bedops.readthedocs.io/en/latest/content/overview.html#overview">overview</a> section of the <strong>BEDOPS v2.4.26</strong> documentation summarizes the toolkit, functionality and performance enhancements. The <a href="https://bedops.readthedocs.io/en/latest/index.html#reference">reference</a> table offers documentation for all applications and scripts.</p><p>Address of the bookmark: <a href="https://github.com/bedops/bedops" rel="nofollow">https://github.com/bedops/bedops</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>