That is the challenge researchers face when studying how bacteria adapt to different environments. A bacterial gene may appear to be linked to a particular habitat, when the real reason is simply that closely related bacteria happen to live there.

In their 2025 Genome Biology paper, Bujdoš, Walter, and O’Toole introduce aurora, a machine-learning tool designed to tackle this problem.

Aurora identifies potentially mislabeled or unusual bacterial strains before performing genome-wide association studies (GWAS). By cleaning up the dataset and accounting for bacterial evolutionary relationships, it can help researchers find genetic features that are more genuinely connected to habitat adaptation.

The researchers tested aurora using simulated and real bacterial datasets and found that it could recover important genetic associations even when datasets contained misleading labels.

The bigger lesson is simple: better biological discoveries often begin with better data.

Aurora gives researchers a new way to separate real genetic clues from misleading ones—and could help us better understand how bacteria adapt, survive, and evolve in the environments they call home.

Based on Bujdoš et al., “aurora: a machine learning GWAS tool for analyzing microbial habitat adaptation,” Genome Biology (2025).[Read the original paper](https://link.springer.com/article/10.1186/s13059-025-03524-7?)

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Research Directions

Stony corals: evolution of novelty and photosymbiosis

Symbiotic acoels: cell type evolution and photosymbiosis

Animal genomes: structural evolution and gene regulation

https://sgel.biodiv.tw/home

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Address of the bookmark: https://github.com/bergmanlab/mcclintock

This bookmark is created to provide NGS online books links.

Address of the bookmark: http://en.wikibooks.org/wiki/Next_Generation_Sequencing_%28NGS%29/Print_version

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83

The work in our lab has focussed on computational approaches to speed-up the finishing process. Specifically, we have explored the use of optical mapping and mate-pair data to augment assemblies and direct finishing experiments. The tools developed in our lab have been used in several finishing projects, producing complete genomes (and near-complete ones) with surprisingly little computational and experimental effort (Nagarajan et al., in submission). The executables (as well as source code) for these tools are freely available here:

• Scaffolding using Optical Restriction Mapping
  Optical Maps are global, ordered maps of restriction site locations in a genome. This information can be quite useful in scaffolding contigs from a shotgun assembly to guide the finishing process. A set of programs to exploit optical maps for assembly can be found here: SOMA v2.0 (63 MB tar.gz file). This version of SOMA contains several improvements to programs in v1.0 as well as new scripts for working with multiple maps, contig graphs and scaffolds. 
  
  
• Augmenting assemblies with mate-pair data
  Mate-pair information can be valuable in augmenting short-read assemblies and reconstructing the genome as larger scaffolds. AMOS-Hybrid is a pipeline written in the AMOS framework (open-source assembly tools) to merge arbitrary mated reads into an existing assembly and merge contigs and create scaffolds where possible. Source code and executables for AMOS-Hybrid are available here: AMOS-Hybrid v1.0 (142 MB tar.gz file). 
  
  
• Assembly and sequence-composition guided finishing
  Contigs from a shotgun assembly are typically linked together in a graph structure that can serve to guide finishing and in some case close gaps in-silico. Also, in many cases, sequence composition of contigs can provide clues to fill gaps in scaffolds. A set of scripts to automate some of these tasks can be found here: Finishing Scripts v1.0 (63 MB tar.gz file). 

http://www.cbcb.umd.edu/finishing/

Address of the bookmark: http://www.cbcb.umd.edu/finishing/