Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Address of the bookmark: https://github.com/martinjvickers/KAST

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Address of the bookmark: https://github.com/sc932/ALE

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

To find repeats in a genome from 2 to 9 length using a Perl script, you can use the RepeatMasker tool with the "--length" option[0]. Here's a step-by-step guide:

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83

Overview of SLiM and msprime

SLiM: Forward Genetic Simulator

SLiM is a free, open-source tool designed for forward genetic simulations. It allows researchers to model complex evolutionary scenarios, including selection, recombination, and demographic events, making it particularly useful for studying adaptation and selection in populations.

Key Features of SLiM:

• Simulates population evolution forward in time

• Supports custom evolutionary models using an embedded scripting language

• Allows modeling of spatial and ecological dynamics

• Provides high flexibility and extensibility for user-defined scenarios

• Available on GitHub as an open-source project

msprime: Ancestry and Mutation Simulator

msprime is an efficient, open-source tool that simulates ancestry and mutations using a coalescent framework. It is known for its high-speed performance and low memory requirements, making it a popular choice for large-scale genomic simulations.

Key Features of msprime:

• Implements coalescent simulations for ancestry modeling

• Efficiently simulates large population histories

• Supports the addition of mutations to genealogies

• Developed using an open-source community model

• Often faster and more memory-efficient than alternative simulators

Using SLiM and msprime with slendr

Both SLiM and msprime can be integrated with slendr, a framework that facilitates structured population genetic simulations. This integration allows for seamless comparison of simulation outputs.

How They Work Together:

• SLiM and msprime simulations can be analyzed within slendr.

• The ts_read() function in slendr enables loading and comparing tree sequence outputs from both simulators.

• This integration allows researchers to validate simulation results and gain deeper insights into evolutionary processes.

Performance Considerations

While SLiM offers powerful forward simulations with extensive customization, msprime is often preferred for its speed and memory efficiency when simulating ancestry and mutations. The choice between the two depends on the research goals:

• For detailed evolutionary modeling with selection and recombination: Use SLiM.

• For large-scale coalescent simulations with mutations: Use msprime.

• For comparing different simulation models and their outputs: Use slendr to integrate SLiM and msprime results.

Conclusion

SLiM and msprime are valuable tools for genome simulation, each serving distinct but complementary purposes in population genetics research. By leveraging the strengths of both simulators with slendr, researchers can conduct robust and efficient evolutionary simulations, enhancing our understanding of genetic diversity and adaptation.

For more information, check out the official GitHub repositories for SLiM and msprime, and explore the slendr framework for streamlined simulation workflow