BOL: Related items

Research Fellows at AIMSCS, Hyderabad

Wed, 06 May 2015 06:23:33 -0500

C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS) - Hyderabad, Andhra Pradesh
Advertisement No.: 5/2015

Research Fellows Systems Biology job vacancy in C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS)

JRF : Qualification - M. Sc in Bioinformatics, Systems Biology, M. Sc statistics, or M. Tech in Bioinformatics,

Pay Scale : Rs. 25,000

SRF : Qualification- Qualification prescribed for JRF with 2 years of research experience.

Pay Scale : Rs. 28,000*

No.of Post: 2

Desirable: Candidates should have strong background in Computational biology, bioinformatics, statistics and algorithmic development. In addition to that previous experience of working on Linux, bio-informatics, NGS data analysis and Basic knowledge of biology is desirable. Programming on any one of the programming languages (C, C++, perl, python) and statistical framework (e.g. R, matlab, etc.) is highly desirable.

More at http://www.crraoaimscs.org/jrf_application_form_2015.pdf

SneakySnake: A Fast and Accurate Universal Genome Pre-Alignment Filter for CPUs, GPUs, and FPGAs

Neel — Sun, 20 Dec 2020 01:39:54 -0600

The first and the only pre-alignment filtering algorithm that works efficiently and fast on modern CPU, FPGA, and GPU architectures. SneakySnake greatly (by more than two orders of magnitude) expedites sequence alignment calculation for both short (Illumina) and long (ONT and PacBio) reads. Described by Alser et al. (preliminary version at https://arxiv.org/abs/1910.09020).

Address of the bookmark: https://github.com/CMU-SAFARI/SneakySnake

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Simons Genome Diversity Project

Jit — Sat, 08 May 2021 21:55:25 -0500

Complete genome sequences from more than one hundred diverse human populations

All genomes in the dataset were sequenced to at least 30x coverage using Illumina technology. The sequencing reads were mapped and genotyped using a customized procedure that was optimized for population genetic analysis. The researchers eliminated bias of alleles toward matching the human genome reference sequence, and determined genotypes on a single-sample basis to avoid preferential calling of genotypes from populations that had more individuals represented.

Address of the bookmark: https://www.simonsfoundation.org/simons-genome-diversity-project/

HISAT2 Index Files Download !

LEGE — Wed, 15 Sep 2021 22:17:49 -0500

Resource for downloading all the HISAT2 related files

Please cite:

Kim, D., Paggi, J.M., Park, C. et al. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol 37, 907–915 (2019). https://doi.org/10.1038/s41587-019-0201-4

Address of the bookmark: http://daehwankimlab.github.io/hisat2/download/#h-sapiens

Rosenberg lab

Wed, 27 May 2015 17:52:24 -0500

Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

UniqueKmer: Generate unique KMERs for every contig in a FASTA file

Abhi — Fri, 17 Dec 2021 00:08:15 -0600

Generate unique k-mers for every contig in a FASTA file.

Unique k-mer is consisted of k-mer keys (i.e. ATCGATCCTTAAGG) that are only presented in one contig, but not presented in any other contigs (for both forward and reverse strands).

This tool accepts the input of a FASTA file consisting of many contigs, and extract unique k-mers for each contig.

The output unique k-mer file and Genome file can be used for fastv: https://github.com/OpenGene/fastv, which is an ultra-fast tool to identify and visualize microbial sequences from sequencing data.

https://github.com/OpenGene/UniqueKMER

Address of the bookmark: https://github.com/OpenGene/UniqueKMER

JRF Bioinformatics @ ICAR - National Research Centre for Orchids Pakyong

Thu, 28 May 2015 19:33:19 -0500

ICAR - National Research Centre for Orchids

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

KAST

Neel — Wed, 23 Feb 2022 08:28:36 -0600

Perform Alignment-free k-tuple frequency comparisons from sequences. This can be in the form of two input files (e.g. a reference and a query) or a single file for pairwise comparisons to be made.

Address of the bookmark: https://github.com/martinjvickers/KAST

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}