<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30111?offset=720</link>
	<atom:link href="https://bioinformaticsonline.com/related/30111?offset=720" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</guid>
	<pubDate>Wed, 07 Feb 2018 10:44:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</link>
	<title><![CDATA[GenomeTools: The versatile open source genome analysis software]]></title>
	<description><![CDATA[<p>The&nbsp;<em>GenomeTools</em>&nbsp;genome analysis system is a&nbsp;<a href="http://genometools.org/license.html">free</a>&nbsp;collection of bioinformatics&nbsp;<a href="http://genometools.org/tools.html">tools</a>&nbsp;(in the realm of genome informatics) combined into a single binary named&nbsp;<em>gt</em>. It is based on a C library named &ldquo;libgenometools&rdquo; which consists of several modules.</p>
<p>If you are interested in gene prediction, have a look at&nbsp;<a href="http://genomethreader.org/" title="GenomeThreader gene prediction        software"><em>GenomeThreader</em></a>.</p><p>Address of the bookmark: <a href="http://genometools.org/" rel="nofollow">http://genometools.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/14800/a-comprehensive-atlas-of-human-gene-activity-released</guid>
	<pubDate>Tue, 02 Sep 2014 14:20:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/14800/a-comprehensive-atlas-of-human-gene-activity-released</link>
	<title><![CDATA[A comprehensive atlas of human gene activity released !!!]]></title>
	<description><![CDATA[<div><div id="postDescription_4018558404"><p>A large international consortium of researchers has produced the first comprehensive, detailed map of the way&nbsp;<a href="http://www.hsph.harvard.edu/news/topic/genetics/" target="_blank">genes</a>&nbsp;work across the major cells and tissues of the human body. The findings describe the complex networks that govern gene activity, and the new information could play a crucial role in identifying the genes involved with disease.</p><p><img src="http://www.kurzweilai.net/images/Coexpression-clustering.jpg" alt="image" width="640" height="460" style="border: 0px; border: 0px;"></p><p>We are able to pinpoint the regions of the genome that can be active in a disease and in normal activity, whether it&rsquo;s in a brain cell, the skin, in blood stem cells or in hair follicles. This is a major advance that will greatly increase our ability to understand the causes of disease across the body.</p><p>The research is outlined in a series of papers published March 27, 2014, two in the journal&nbsp;<em>Nature</em>&nbsp;and 16 in other scholarly journals. The work is the result of years of concerted effort among 250 experts from more than 20 countries as part of&nbsp;<a href="http://fantom.gsc.riken.jp/" target="_blank">FANTOM 5 (Functional Annotation of the Mammalian Genome)</a>. The FANTOM project, led by the Japanese institution RIKEN, is aimed at building a complete library of human genes.</p><p>Researchers studied human and mouse cells using a new technology called Cap Analysis of Gene Expression (CAGE), developed at RIKEN, to discover how 95% of all human genes are switched on and off. These &ldquo;switches&rdquo; &mdash; called &ldquo;promoters&rdquo; and &ldquo;enhancers&rdquo; &mdash; are the regions of DNA that manage gene activity. The researchers mapped the activity of 180,000 promoters and 44,000 enhancers across a wide range of human cell types and tissues and, in most cases, found they were linked with specific cell types.</p><p>Referene : www.kurzweilai.net/first-comprehensive-atlas-of-human-gene-activity-released</p></div></div>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</guid>
	<pubDate>Tue, 17 Apr 2018 16:21:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</link>
	<title><![CDATA[AlignGraph: algorithm for secondary de novo genome assembly guided by closely related references]]></title>
	<description><![CDATA[<p>AlignGraph is a software that extends and joins contigs or scaffolds by reassembling them with help provided by a reference genome of a closely related organism.</p>
<p>Using AlignGraph</p>
<pre><code>AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]</code></pre>
<h3>&nbsp;</h3><p>Address of the bookmark: <a href="https://github.com/baoe/AlignGraph" rel="nofollow">https://github.com/baoe/AlignGraph</a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/14927/which-of-the-following-programming-language-is-best-for-a-bioinformatics-beginner</guid>
	<pubDate>Thu, 04 Sep 2014 07:51:16 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/14927/which-of-the-following-programming-language-is-best-for-a-bioinformatics-beginner</link>
	<title><![CDATA[Which of the following programming language is best for a bioinformatics beginner?]]></title>
	<description><![CDATA[<p>I will be doing NGS in the course of my research work and I will like to learn a programming language which is compatible with most bioinformatics tools or software. I basically want to do de-novo assembly, map reads, align reads, and expression analysis. Recommendations welcomed. Which languages would you recommend to a student wishing to enter the world of bioinformatics?</p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/16160/research-scientist-%E2%80%93-bioinformatics-at-sidra-medical-and-research-center</guid>
  <pubDate>Wed, 10 Sep 2014 14:35:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Scientist – Bioinformatics at Sidra Medical and Research Center]]></title>
  <description><![CDATA[
<p>Sidra Medical and Research Center(Doha, Qatar) is looking for talented Research Scientists (Bioinformatics / NGS Data Analysis).</p>

<p>Research Scientists within the Bioinformatics Program are involved in research related to cutting edge genomics and analysis of omics data. The research will utilize concepts, theories and best practices obtained from bioinformatics discipline and applied to biological and other biomedical data for analysis. The role may also involve designing databases, algorithm and/or computation methods for analyzing genomics and other omics data.  The scientist will be working closely with the Translational Medicine Program within a state-of-the art research setting.</p>

<p>Please check the details of the opening and apply here: http://careers.sidra.org/sidra/Vacan...acancyID=60181</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/16472/internship-nipgr</guid>
  <pubDate>Sat, 13 Sep 2014 16:02:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[INTERNSHIP @ NIPGR]]></title>
  <description><![CDATA[
<p>Applications are invited from suitable candidates for six months ‘Training Fellowship' at National Institute of Plant Genome Research (NIPGR).</p>

<p>About National Institute Of Plant Genome Research (NIPGR) http://www.nipgr.res.in/</p>

<p>The National Institute of Plant Genome Research is an autonomous institution supported by the Department of Biotechnology, Government of India. It is committed to make the institute a premier Institution for plant genomic research in the country. It was established to contribute in the achievement of such hopes as a part of national effort for meeting the challenges in the midst of fast pace of international genomic research and grasping of opportunities on long-term basis.</p>

<p>About the Internship:</p>

<p>The selected intern(s) will work in the area of in Bioinformatics under the BTISNET program of DBT in the Distributed Information Sub center (DISC) facility at NIPGR, New Delhi, under the supervision of Dr. Gitanjali Yadav, Scientist, NIPGR.</p>

<p>Who can apply:</p>

<p>Students currently pursuing the final year of Masters Degree (or equivalent) in Bioinformatics/Biotechnology with strong interest in Computational Biology and First class/division throughout academic career may apply.</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/16682/java-utilities-for-next-generation-sequencing-by-pierre-lindenbaum</guid>
	<pubDate>Mon, 15 Sep 2014 17:24:49 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/16682/java-utilities-for-next-generation-sequencing-by-pierre-lindenbaum</link>
	<title><![CDATA[Java utilities for Next Generation Sequencing  by Pierre Lindenbaum]]></title>
	<description><![CDATA[<div>
<div>
<p>Java utilities for Bioinformatics</p>
</div>
<div>
<p><a href="https://github.com/lindenb/jvarkit">https://github.com/lindenb/jvarkit</a></p>
</div>
</div><p>Address of the bookmark: <a href="https://github.com/lindenb/jvarkit" rel="nofollow">https://github.com/lindenb/jvarkit</a></p>]]></description>
	<dc:creator>Robert M Willioms</dc:creator>
</item>

</channel>
</rss>