<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30111?offset=850</link>
	<atom:link href="https://bioinformaticsonline.com/related/30111?offset=850" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/16160/research-scientist-%E2%80%93-bioinformatics-at-sidra-medical-and-research-center</guid>
  <pubDate>Wed, 10 Sep 2014 14:35:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Scientist – Bioinformatics at Sidra Medical and Research Center]]></title>
  <description><![CDATA[
<p>Sidra Medical and Research Center(Doha, Qatar) is looking for talented Research Scientists (Bioinformatics / NGS Data Analysis).</p>

<p>Research Scientists within the Bioinformatics Program are involved in research related to cutting edge genomics and analysis of omics data. The research will utilize concepts, theories and best practices obtained from bioinformatics discipline and applied to biological and other biomedical data for analysis. The role may also involve designing databases, algorithm and/or computation methods for analyzing genomics and other omics data.  The scientist will be working closely with the Translational Medicine Program within a state-of-the art research setting.</p>

<p>Please check the details of the opening and apply here: http://careers.sidra.org/sidra/Vacan...acancyID=60181</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/16472/internship-nipgr</guid>
  <pubDate>Sat, 13 Sep 2014 16:02:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[INTERNSHIP @ NIPGR]]></title>
  <description><![CDATA[
<p>Applications are invited from suitable candidates for six months ‘Training Fellowship' at National Institute of Plant Genome Research (NIPGR).</p>

<p>About National Institute Of Plant Genome Research (NIPGR) http://www.nipgr.res.in/</p>

<p>The National Institute of Plant Genome Research is an autonomous institution supported by the Department of Biotechnology, Government of India. It is committed to make the institute a premier Institution for plant genomic research in the country. It was established to contribute in the achievement of such hopes as a part of national effort for meeting the challenges in the midst of fast pace of international genomic research and grasping of opportunities on long-term basis.</p>

<p>About the Internship:</p>

<p>The selected intern(s) will work in the area of in Bioinformatics under the BTISNET program of DBT in the Distributed Information Sub center (DISC) facility at NIPGR, New Delhi, under the supervision of Dr. Gitanjali Yadav, Scientist, NIPGR.</p>

<p>Who can apply:</p>

<p>Students currently pursuing the final year of Masters Degree (or equivalent) in Bioinformatics/Biotechnology with strong interest in Computational Biology and First class/division throughout academic career may apply.</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/16682/java-utilities-for-next-generation-sequencing-by-pierre-lindenbaum</guid>
	<pubDate>Mon, 15 Sep 2014 17:24:49 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/16682/java-utilities-for-next-generation-sequencing-by-pierre-lindenbaum</link>
	<title><![CDATA[Java utilities for Next Generation Sequencing  by Pierre Lindenbaum]]></title>
	<description><![CDATA[<div>
<div>
<p>Java utilities for Bioinformatics</p>
</div>
<div>
<p><a href="https://github.com/lindenb/jvarkit">https://github.com/lindenb/jvarkit</a></p>
</div>
</div><p>Address of the bookmark: <a href="https://github.com/lindenb/jvarkit" rel="nofollow">https://github.com/lindenb/jvarkit</a></p>]]></description>
	<dc:creator>Robert M Willioms</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/17505/kau-thrissur-biotechbioinformatics-rasrfjrftraineestudentships</guid>
  <pubDate>Fri, 26 Sep 2014 20:07:28 -0500</pubDate>
  <link></link>
  <title><![CDATA[KAU Thrissur Biotech/Bioinformatics RA/SRF/JRF/Trainee/Studentships]]></title>
  <description><![CDATA[
<p>Applications are invited from eligible candidates for the following posts at Bioinformatics Centre (DIC), IT- BT Complex, College of Horticulture, Kerala Agricultural University, Vellanikkara, Thrissur.</p>

<p>1. Research Associate <br />Emoluments*: 14880/- + HRA 	<br />Qualification needed: Ph.D/M.Sc in Bioinformatics or Ph.D/M.Sc in Agriculture or Biotechnology with advanced Diploma in Bioinformatics <br />Desirable: 2 year experience in Bioinformatics.</p>

<p>2 Senior Research Fellow <br />Emoluments*: 10230/- 	<br />Qualification needed: M.Sc/ M.tech in Bioinformatics or M.Sc in Agriculture/ Biotechnology with Diploma in Bioinformatics. <br />Desirable: One year experience in Bioinformatics</p>

<p>3 Junior Research Fellow <br />Emoluments*: 9300/- 	<br />Qualification needed: M.Sc/ M.tech in Bioinformatics or M.Sc in Agriculture/Biotechnology/Plant Sciences with Diploma in Bioinformatics.</p>

<p>4 .Trainee/Studentship Bioinformatics <br />Emoluments*: 5000/- 	<br />Qualification needed: M.Sc in Bioinformatics with good knowledge of Bioinformatics softwares and tools.</p>

<p>5 Trainee/ Studentship Biotechnology <br />Emoluments*: 5000/- 	<br />Qualification needed: M.Sc in Biotechnology, with working knowledge in tissue culture, molecular markers and cloning of genes.</p>

<p>Candidates with the required qualifications and experience may give an application in the prescribed format with attested copies of certificates to prove eligibility on or before 30th November 2014. The applications are to be addressed to The Associate Dean, College of Horticulture and send to "Professor &amp; Coordinator, Bioinformatics Centre (DIC), IT-BT Complex, Kerala Agricultural University, Vellanikkara, Thrissur, Kerala 680 656”. The envelope may be superscribed “Application for the post at Bioinformatics Centre”.</p>

<p>*Emoluments are likely to be revised in 2014-2015</p>

<p>More at http://www.kaubic.in/downloads/Notification_bic.pdf<br />http://www.kaubic.in/downloads/Application%20form.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/17894/faculty-position-at-national-institute-of-technology-rourkela</guid>
  <pubDate>Sun, 05 Oct 2014 15:45:13 -0500</pubDate>
  <link></link>
  <title><![CDATA[FACULTY POSITION at NATIONAL INSTITUTE OF TECHNOLOGY, ROURKELA]]></title>
  <description><![CDATA[
<p>NIT, Rourkela, an institute of national importance under Ministry of HRD, Govt. of India invites applications from Indian nationals possessing excellent academic background along with commitment to quality teaching and research for faculty positions at the level of Professor, Associate Professor and Assistant Professor in most branches of Engineering, Science, Management and Humanities as per following table:-</p>

<p>    1 Asst. Professor (on Pre-Ph.D. Contract)</p>

<p>    2 Asst. Professor (on Contract)</p>

<p>    3 Asst. Professor</p>

<p>    4 Associate Professor</p>

<p>    5 Professor</p>

<p>Life Sciences:-</p>

<p>    i)Biochemistry and Molecular Biology; ii)Cell and Developmental Biology; iii)Immunology and Molecular Medicine; (iv) Microbiology and Ecology (v)Bioinformatics Group; vi)Biophysical Sciences</p>

<p>HOW TO APPLY:-</p>

<p>a. Candidates willing to apply for one or more posts are requested to apply online at “http://www.nitrkl.ac.in/ JOBS &amp; TENDERS /Faculty Position” .<br />b. Persons employed in Government and Semi-Government organizations may apply directly against the standing advertisement. For this the application should be completed online. The printout of the application generated online should be submitted through employer if shortlisted for interview.<br />c. The online application can be filled in multiple sessions.<br />d. Candidates are required to check the Institute website from time to time for latest information, application status call for interview, change of dates and final results.<br />e. Applications shall be received online only. Please do not send application or CV against this advertisement by email or letter mail.</p>

<p>More Info: http://nitrkl.ac.in/Jobs_Tenders/1FacultyPosition/Default.aspx</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/17924/software-developed-in-pevsner-lab</guid>
	<pubDate>Mon, 06 Oct 2014 12:41:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/17924/software-developed-in-pevsner-lab</link>
	<title><![CDATA[Software developed in pevsner lab]]></title>
	<description><![CDATA[<div>
<div id="block-system-main">
<div>
<div id="node-7">
<div>
<div>
<div>
<div>
<p><a href="http://pevsnerlab.kennedykrieger.org/dragon.htm">DRAGON</a>: Database Referencing of Array Genes Online</p>
<p><a href="http://pevsnerlab.kennedykrieger.org/php/node/96">SNOMAD</a>: Standardization and Normalization of Microarray Data</p>
<p><a href="http://pevsnerlab.kennedykrieger.org/php/node/70">SNPduo</a>: SNP Analysis Between Two Individuals</p>
<p><a href="http://pevsnerlab.kennedykrieger.org/php/node/71">SNPtrio</a>: Analyzing and Visualizing and Inheritance Patterns in Trios</p>
<p><a href="http://pevsnerlab.kennedykrieger.org/php/node/64">SNPscan</a>: Data Analysis and Visualization of SNP Data</p>
<p><a href="http://pevsnerlab.kennedykrieger.org/php/node/64">pediSNP</a>: Analyze SNP Data From a Pedigree of Two Generations</p>
<p><a href="http://pevsnerlab.kennedykrieger.org/php/node/73">kcoeff</a>: Calculate Cotterman Coefficients of SNP Genotype Data</p>
<p><a href="http://pevsnerlab.kennedykrieger.org/php/node/113">triPOD:</a> Detects chromosomal abnormalities in parent-child trio-based microarray data</p>
</div>
</div>
</div>
</div>
</div>
</div>
</div>
</div><p>Address of the bookmark: <a href="http://pevsnerlab.kennedykrieger.org/php/?q=software" rel="nofollow">http://pevsnerlab.kennedykrieger.org/php/?q=software</a></p>]]></description>
	<dc:creator>Robert M Willioms</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</guid>
	<pubDate>Fri, 26 Oct 2018 08:25:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</link>
	<title><![CDATA[MITOS: improved de novo metazoan mitochondrial genome annotation]]></title>
	<description><![CDATA[<p><span>Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.</span></p><p>Address of the bookmark: <a href="http://mitos.bioinf.uni-leipzig.de/index.py" rel="nofollow">http://mitos.bioinf.uni-leipzig.de/index.py</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>