<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/3013?offset=1230</link>
	<atom:link href="https://bioinformaticsonline.com/related/3013?offset=1230" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23121/senior-sas-programmer-urgent-role-permanant-welwyn-garden-city-uk</guid>
  <pubDate>Fri, 03 Jul 2015 08:14:23 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior SAS Programmer - URGENT ROLE - Permanant - Welwyn Garden City - UK]]></title>
  <description><![CDATA[
<p>SAS Programmer URGENTLY required !! My client is looking for an experienced Senior SAS Programmer, to join their bubbly dynamic team in Welwyn Garden City. You must have experience within SAS and/or R programming language. I am looking for someone with a background within either Life Sciences, Statistics, Computer Science, Bioinformatics etc. I am looking for someone with leadership qualities, you must have excellent analyst skills. Please call Dareen Evans on 01772 278050 or email your cv to dareen.evans@itworkshealth.co.uk</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8123/jrf-manit</guid>
  <pubDate>Sun, 02 Feb 2014 03:07:58 -0600</pubDate>
  <link></link>
  <title><![CDATA[JRF @ MANIT]]></title>
  <description><![CDATA[
<p>MAULANA AZAD NATIONAL INSTITUTE OF TECHNOLOGY BHOPAL</p>

<p>No. CSE/14/1038</p>

<p>Walk in Interview for the post of JRF under TEQIP-II</p>

<p>SN Department – Qualification Post Graduation – Time</p>

<p>1 Bio-Informatics &amp; Mathematics M.Tech Bio-informatics/M.Sc.* Maths  10.00 AM</p>

<p>2 Biological Sciences M.Sc.* in any branch of Biological Sciences 10.30 AM</p>

<p>3 Chemical Engineering M.Tech Chemical Engineering 11.00 AM</p>

<p>4 Chemistry M.Sc.* Chemistry 11.30 AM</p>

<p>5 Civil Engineering M.Tech Structure/GeoTech. /Water -Resources/Hydraulics/Environment/Transport 12.00 Noon</p>

<p>6 GIS M.Tech GIS/Civil 12.30 PM</p>

<p>7 Computer Science &amp; Engineering M.Tech CSE/Information Security 01.00 PM</p>

<p>8 Electrical Engineering M.Tech Electrical Derives 01.30 PM</p>

<p>9 Electronics &amp; Communication M.Tech Digital Communication 02.00 PM</p>

<p>10 MSME M.Tech Material Science/ Mechanical/Metallurgy 02.30 PM</p>

<p>11 Physics M.Sc.* Physics 03.00 PM</p>

<p>* M.Sc. with NET/GATE qualified</p>

<p>Resume along with one passport size photograph and relevant documents are required at the time of interview</p>

<p>Amount of Fellowship: Rs 18000/-month+ HRA</p>

<p>Duration: 31st Dec 2014 (End of TEQIP-II project)</p>

<p>Date of Interview: 7th  February 2014</p>

<p>Venue Institute Committee Room</p>

<p>Advertisement:</p>

<p>http://www.manit.ac.in/manitbhopal/Year2014/Recruitment/Advertisement%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</guid>
	<pubDate>Thu, 07 Dec 2017 08:46:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</link>
	<title><![CDATA[Edit distance application in bioinformatics !]]></title>
	<description><![CDATA[<p>There are other popular measures of&nbsp;<a href="https://en.wikipedia.org/wiki/Edit_distance" title="Edit distance">edit distance</a>, which are calculated using a different set of allowable edit operations. For instance,</p><ul>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance" title="Damerau&ndash;Levenshtein distance">Damerau&ndash;Levenshtein distance</a>&nbsp;allows insertion, deletion, substitution, and the&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>&nbsp;of two adjacent characters;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Longest_common_subsequence_problem" title="Longest common subsequence problem">longest common subsequence</a>&nbsp;(LCS) distance allows only insertion and deletion, not substitution;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Hamming_distance" title="Hamming distance">Hamming distance</a>&nbsp;allows only substitution, hence, it only applies to strings of the same length.</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Jaro_distance" title="Jaro distance">Jaro distance</a>&nbsp;allows only&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>.</li>
</ul><p>&nbsp;</p><pre><span>use</span> Text<span>::</span>Levenshtein <span>qw</span><span>(</span>distance<span>);</span>

 <span>print</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>"four"</span><span>);</span>
 <span># prints "2"</span>

 <span>my</span> <span>@words</span>     <span>=</span> <span>qw</span><span>/ four foo bar /</span><span>;</span>
 <span>my</span> <span>@distances</span> <span>=</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>@words</span><span>);</span>

 <span>print</span> <span>"@distances"</span><span>;</span>
 <span># prints "2 0 3"</span><br /><br /><br /></pre><pre><span>use</span> Algorithm<span>::</span>LCSS <span>qw</span><span>(</span> LCSS CSS CSS_Sorted <span>);</span>
    <span>my</span> <span>$lcss_ary_ref</span> <span>=</span> <span>LCSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array</span>
    <span>my</span> <span>$lcss_string</span>  <span>=</span> <span>LCSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># string</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>    <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>      <span># ref to array of strings</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># ref to array of strings<br /><br /><br /><br /></span></pre><p>There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshteinXS">Text::LevenshteinXS</a>&nbsp;and&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3AXS">Text::Levenshtein::XS</a>&nbsp;are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.</p><p>The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau">Text::Levenshtein::Damerau</a>&nbsp;defaults to using a pure perl implementation, but if you've installed&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau%3A%3AXS">Text::Levenshtein::Damerau::XS</a>&nbsp;then it will be a lot quicker.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AWagnerFischer">Text::WagnerFischer</a>&nbsp;is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ABrew">Text::Brew</a>&nbsp;is an implementation of the Brew edit distance, which is another algorithm based on edit weights.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy">Text::Fuzzy</a>&nbsp;provides a number of operations for partial or fuzzy matching of text based on edit distance.&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy%3A%3APP">Text::Fuzzy::PP</a>&nbsp;is a pure perl implementation of the same interface.</p><p><a href="http://search.cpan.org/perldoc?String%3A%3ASimilarity">String::Similarity</a>&nbsp;takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ADice">Text::Dice</a>&nbsp;calculates&nbsp;<a href="https://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient">Dice's coefficient</a>&nbsp;for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.</p><pre><span>&nbsp;</span></pre>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8287/post-doc-in-computational-genetics-and-genomics-at-ceinge-biotecnologie-avanzate-naples-italy</guid>
  <pubDate>Tue, 11 Feb 2014 08:06:47 -0600</pubDate>
  <link></link>
  <title><![CDATA[Post doc in Computational Genetics and Genomics at CEINGE Biotecnologie Avanzate, Naples, Italy]]></title>
  <description><![CDATA[
<p>We are seeking one motivated scientist to analyze genomics and transcriptomics data of a large collection of neuroblastoma tumors. The successful candidate will be part of a team of researchers with extensive expertise in genome cancer study. He/she will be involved in the analysis of DNA-seq, RNA-seq, ChIP-seq data using available methods running in R and UNIX environment.</p>

<p>Qualifications</p>

<p>PhD or Post-Graduated Master degree is required. Successful candidates will have some expertise in data analysis of NGS data by using methods running in R and UNIX environment. Familiarity with genome databases and browsers is required.</p>

<p>Application</p>

<p>Candidates should send a CV and a brief personal statement focusing on their skills and interests related to the research project.</p>

<p>Contacts</p>

<p>Start date: 1° April 2014<br />Salary on grant: 25,000 euros per year.<br />Contact Person (Referent): Mario Capasso<br />Ref. Email: mario.capasso@unina.it and achille.iolascon@unina.it<br />Tel: +39 081 3737889</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/8317/new-version-of-modeller-913</guid>
	<pubDate>Thu, 13 Feb 2014 09:07:57 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/8317/new-version-of-modeller-913</link>
	<title><![CDATA[New version of Modeller, 9.13]]></title>
	<description><![CDATA[<p>The new version of Modeller, 9.13, is now available for download! Please see the download page at <a href="http://www.facebook.com/l.php?u=http%3A%2F%2Fsalilab.org%2Fmodeller%2F&amp;h=mAQG5wo_Z&amp;enc=AZOoq2B7BxT95AT3Mw3za3VlbmRFke43YMI5vAjCAbBlIcf3bptn8pmFC1Idxrssy98117S03IgdcNmEWcQBi9bmi8Or_ut1D1yybt1ZonvPoCT3_LOglcYV7o6bEaa442_6LhbjefEaelkq0aq6dl0w&amp;s=1" target="_blank">http://salilab.org/modeller/</a> for more information.</p><p><img src="http://salilab.org/modeller/gifs/modeller.jpg" alt="image" width="848" height="272" style="border: 0px; border: 0px;"><br /> <br /> If you have a license key for Modeller 8 or 9, there is no need to reregister for Modeller 9.13 - the same license key will work. (It won't <span>do any harm to reregister if you want to, though!)<br /> <br /> 9.13 is primarily a bugfix release relative to the last public release(9.12). Major user-visible changes include:<br /> <br /> # Modeller now includes a variety of SOAP (statistically optimized atomic potential) scores for assessing proteins, loops, and interfaces.<br /> <br /> # The Lennard-Jones interaction energy is now artificially truncated at very short distance; this makes simulations with poor starting conditions much less likely to 'blow up'.<br /> <br /> # model.get_insertions(), model.get_deletions() and model.loops() now have an include_termini option; if False, residue ranges that include chain termini are excluded from the output.<br /> <br /> See the Modeller manual for a full change log: <a href="http://salilab.org/modeller/9.13/manual/node39.html" target="_blank">http://salilab.org/modeller/9.13/manual/node39.html</a><br /> <br /> If you encounter bugs in Modeller 9.13, please see <a href="http://salilab.org/modeller/9.13/manual/node10.html" target="_blank">http://salilab.org/modeller/9.13/manual/node10.html</a> for information on how to report them.</span></p><p><span>Reference:</span></p><p><span>http://salilab.org/modeller/</span></p>]]></description>
	<dc:creator>Radha Agarkar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/8509/the-best-bioinformatics-computational-biology-quotes</guid>
	<pubDate>Wed, 26 Feb 2014 17:50:59 -0600</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/8509/the-best-bioinformatics-computational-biology-quotes</link>
	<title><![CDATA[The Best Bioinformatics / Computational Biology Quotes]]></title>
	<description><![CDATA[<p><img src="http://bioinformaticsonline.com/mod//photo/hahaha.png" style="border: 0; border: 0px;" alt="image"></p><p>Bioinformatician are not anti-social; We are just genome friendly.</p><p>Bioinformatician would love to change the biological world, but they won't give us the genetic code :P</p><p>If at first you don't succeed; call it version 1.0</p><p>The glass is neither half-full nor half-empty: it's actually have several genomes.</p><p>I'm BioGeek.</p><p>Fedup with LIPS, try God script.</p><p>Idiot, Go ahead, make my data!</p><p>Thank god, my genome just compiled.</p><p>Error message: "Out of space on genome drive:"</p><p>Shut up mobile elements, or i'll flush you out.</p><p>Never underestimate the internet bandwidth, u gotta incomplete.</p><p>Applied fuzzy logic to understand God's logic?</p><p>Warning! Overflow, delete chromosome !</p><p>Be nice to the BioGeek, for all you know they might be the next curator!</p><p>Beware of computational biologist they screw genes and protein.</p><p>Warning! Your genome is full of garbage, delete it !</p><p>Bad or missing mouse genome. Spank the cat? (Y/N)</p><p>Genome make very fast, very accurate mistakes.</p><p>Let's BLAST it.</p><p>Some genome never has transposons. It just develops random features.</p><p>Go watch CINEMA and have BLAST.</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/8987/the-dna-of-a-successful-bioinformatician-decoded</guid>
	<pubDate>Wed, 12 Mar 2014 13:41:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/8987/the-dna-of-a-successful-bioinformatician-decoded</link>
	<title><![CDATA[The DNA of a Successful Bioinformatician decoded !!!]]></title>
	<description><![CDATA[<p>Many blogs exist about successful bioinformatician, but this blog so far now is my personal view on characteristics of successful bioinformatician or computational biologist. &nbsp;Hmm &hellip; of course these views are subjective to my own personal experiences and therefore I don't claim that the view listed here is complete. As a human, I don&rsquo;t take them too serious. The success must not be the only target of your work. The target is to work on your own virtues; some of those virtues are the topic of this blog.</p><p><img src="http://bioinformaticsonline.com/mod/photo/genome_decode.png" alt="image" width="509" height="458" style="border: 0px; border: 0px;"><br /> <br /> <strong>1. Update new things continuously<br /></strong>As per my personal experience, it&rsquo;s not always easy to work as a bioinformatician! &nbsp;There are couple of reasons to say that; First computational part of biology make our life&rsquo;s a little harder compared to other professional categories. The fact - for instance - that the technology cycle in the bioinformatics world is very short, the actual knowledge becomes outdated in a few months or years. Therefore, we need to learn continuously - new things get important. Second, to stay on top of things we really need the strong will to be good at our job. That's probably the most important characteristic to bioinformatician. They are usually an excellent knowledge worker with great technical abilities, and have the will to be that over decades!<br /> <br /> <strong>2. Avoid the sentence </strong><strong>"I did not know what to do!"</strong><br /> In our computational biology lab, we generally face lots of technical problems. But as you know, it's impossible to know everything to do the computational biology jobs ( Yup.. because you need diverse and multidisciplinary knowledge to understand biological problems and resolve their respective solutions), therefore it's absolutely necessary that a bioinformatician finds its way through a new topic. How I typically do that is I use google and I talk to other experts in our laboratory or online biostar community to find out what they think. "I did not know what to do!" should not be an argument for us.<strong><br /><br /> <strong>3. To make oneself useful</strong></strong><br /> Several time it does happen, you finished our task earlier than expected; in such cases if you have some time left then: Take a coffee and play chess; reversi, etc. In my case I take a rest. Afterwards I think about what I could do that helps the team to achieve its targets, 'cause some of my team mates probably didn't finish! (at least if I didn't met them at coffee bar !!)</p><p><strong>4. Care for all</strong><br /> During my rigorous research duration; I attended several workshop organized by my University departments. I had a discussion with other research fellow, professors; I generally ask &hellip; what it really takes to make a team successful or to be a successful research leader. They always said: "Well, you need some caring people!" I think there is a lot truth in that statement. If we do not care about quality, timelines, good team culture, respectful communication (!!), clean code, if all this doesn&rsquo;t matter to us, then I believe the probability is higher that we fail in research and analysis. <br /> <br /> <strong>5. Be good with people</strong><br /> Because bioinformatician and computational biologist jobs typically involves to work in a (most wanted J cross-departmental!) team, therefore it's important that we're (more or less) good in dealing with other individuals. Everyone have their own strengths and weaknesses, just like us. It's important to treat all the research team mates with respect, regardless of their technical competence or contributions. Of course, sometimes people deserve a clear statement (!!!), but try to do these things one-on-one. Make sure nobody loses his face. Attend the meetings at the coffee bar; be good at table top soccer and go out once in a while to have a beer with your team. You know what I'm talking about.</p><p>At the end of a week I look back and I ask myself what I have produced. This could be paperwork, community days or (best!!) programming code. Always remember there is always a solution to a problem. Most of the times there are at least three solutions. So, don&rsquo;t just blame, suggest a solution.<br /> <br /> That's it. I am looking forward to your thoughts and comments!</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>