Address of the bookmark: http://wishart.biology.ualberta.ca/cgview/

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

If you have any questions or comments, post them on one of the trackers on BRIG’s SourceForge page: http://sourceforge.net/tracker/?group_id=328245.

Features:

• Images show similarity between a central reference sequence and other sequences as concentric rings.
• BRIG will perform all BLAST comparisons and file parsing automatically via a simple GUI.
• Contig boundaries and read coverage can be displayed for draft genomes; customized graphs and annotations can be displayed.
• Using a user-defined set of genes as input, BRIG can display gene presence, absence, truncation or sequence variation in a set of complete genomes, draft genomes or even raw, unassembled sequence data.
• BRIG also accepts SAM-formatted read-mapping files enabling genomic regions present in unassembled sequence data from multiple samples to be compared simultaneously

Address of the bookmark: http://brig.sourceforge.net/

kallisto

Address of the bookmark: https://github.com/reubwn/hgt

https://www.nature.com/articles/nmeth.4556

Address of the bookmark: https://github.com/ryanlayer/giggle

https://github.com/MesquiteProject/MesquiteCore

Address of the bookmark: http://mesquiteproject.org/

ESSENTIAL QUALIFICATIONS:
We are looking for a motivated candidate with keen interest in bioinformatics and microbial genome evolution. The candidate must have a Master’s Degree in Bioinformatics, Computational Biology, Computer Science, Microbiology, Biology or a related field with good academic record.

DESIRABLE QUALIFICATIONS
Hands on research experience on handling next generation sequencing data and phylogenetic reconstruction methods. Excellent programming skills (Perl/Python/Java/Php) and experience in working on Unix/Linux platform is preferred. Furthermore; good knowledge is required in statistics (R/Matlab) and the application of bioinformatics analysis tools.

AGE:
Below 28 years as on 15th November, 2016.

EMOLUMENTS:
Rs. 25,000 + 20% HRA for NET/GATE qualified and Post Graduate in Professional Degree course qualified candidates and
Rs. 12,000/- + 20% HRA for others.

DURATION:
Initial appointment will be given for one year and further extension will be based on the performance till termination of the project.
Only those fulfilling the above criteria need apply and will be called for interview. In the event of more than 10 candidates being short-listed by screening the applications, a written test will be conducted before the selection interview and only those who are successful in the written test will be interviewed. No TA/ DA will be given for appearing in the interview.

Suitably qualified candidates may send applications in the prescribed format (Download here) with a photograph, a copy of full resume indicating the percentage of Marks obtained and attested photocopies of credentials & experience to reach the undersigned on or before 15th November, 2016. Envelopes must be superscripted with abbreviated title of the project, advertisement number and job title. Selection to the position will not entitle the candidate to any future positions at RGCB (permanent or otherwise). As with all project positions at RGCB, the position will be co terminus with end of the project.

Date: Nov 11th. 2016 Last Date: Nov 25th. 2016

PROJECT ID: 632

The following posts are urgently required to be filled for the Department of Biotechnology, Government of India funded project entitled "Computational Core for Plant Metabolomics" administrated by Prof Indira Ghosh, School of Computational and Integrative Sciences, Jawaharlal Nehru University, New Delhi-110 067

NB:For all Bioinformatics posts, preference will be given to candidates with a good knowledge of Python and/or R. Knowledge of JAVA will also get a special consideration.

RA / Research Associate (Metabolic engineering/Computational Biologist)

Salary: Rs. 36000/- + HRA
Vacancy: 1
Essential Qualifications: PhD in Bioinformatics /Mathematics/Computer Science with experience in analyzing high throughput omics-based data/ system Biology/ Analysis of Network Biology. Published paper in the field is a must to prove the experience.
Desired Skills: Prior experience in handling and guiding bioinformatics, metabolomics data, planning of new research area in metabolic driven network , managing the project portal, preparing and filing reports etc. Will be expected to communicate with user groups and coordinate with LIMS group in Hyderabad and the Cheminformatics group in Delhi.

RA / Research Associate (Chemo-informatics/Computational Biologist)

Salary: Rs. 36000/- + HRA
Vacancy: 1
Essential Qualifications: PhD in Bioinformatics/ computational biology/ Biophysics/Computer Science. Computational and Chemical structure related experience is a necessary qualification proven by paper published and program developed.
Desired Skills: Research experience in Chemical scaffold mapping, in silico Spectral analysis, Biological Database Designing & Integration is required. Individual is responsible to develop methods related to metabolite identification, Testing and refining and integrate LIMS with IIIT Hyderabad and will be expected to communicate with user groups.

Project SRF (Bioinformatics/Programming)

Salary: As per DBT rules
Vacancy: 1
Essential Qualifications: Masters/B Tech in Basic Sciences with at least 2yrs of research experience in Bioinformatics/Computational Biology related to Database /portal building & maintenance ,high throughput data handling and analysis etc. For M.Sc/B.Tec, Published paper in peer-reviewed Journal and for M.Tech, thesis submission in computational biology is a must.

More at http://www.jnu.ac.in/Career/currentjobs.htm

More at https://dahak-metagenomics.github.io/dahak/

Address of the bookmark: https://github.com/dahak-metagenomics/dahak