<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30147?offset=1180</link>
	<atom:link href="https://bioinformaticsonline.com/related/30147?offset=1180" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</guid>
	<pubDate>Wed, 07 Feb 2018 10:44:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</link>
	<title><![CDATA[GenomeTools: The versatile open source genome analysis software]]></title>
	<description><![CDATA[<p>The&nbsp;<em>GenomeTools</em>&nbsp;genome analysis system is a&nbsp;<a href="http://genometools.org/license.html">free</a>&nbsp;collection of bioinformatics&nbsp;<a href="http://genometools.org/tools.html">tools</a>&nbsp;(in the realm of genome informatics) combined into a single binary named&nbsp;<em>gt</em>. It is based on a C library named &ldquo;libgenometools&rdquo; which consists of several modules.</p>
<p>If you are interested in gene prediction, have a look at&nbsp;<a href="http://genomethreader.org/" title="GenomeThreader gene prediction        software"><em>GenomeThreader</em></a>.</p><p>Address of the bookmark: <a href="http://genometools.org/" rel="nofollow">http://genometools.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8108/jrf-institute-of-cytology-preventive-oncology</guid>
  <pubDate>Sat, 01 Feb 2014 13:47:29 -0600</pubDate>
  <link></link>
  <title><![CDATA[JRF @ Institute of Cytology &amp; Preventive Oncology]]></title>
  <description><![CDATA[
<p>Institute of Cytology &amp; Preventive Oncology (ICPO) which was initially established as Cytology Research Centre ( CRC ) by the Indian Council of Medical Research (ICMR) in 1979, came into the existence in 1989 when CRC was elevated to the level of Institute. ICPO was instituted with the main aim of promoting research in the field of cancers that are most prevalent in India with an emphasis on their early detection and prevention.</p>

<p>Candidates having the below mentioned qualifications may appear for Walk in Interview at ICPO on 5th Feb 2014 between 10.00 AM and 12.00 PM under the NIF project entitled "Prediction of drug tragets of chemical constituents present within non-codified medicinal plants" under Dr Subhash M.Agarwal, Scientist C</p>

<p>    Position : JRF<br />    No of Post : One<br />    Pay : Rs 12000/- + 30% HRA </p>

<p>    Desired Profile : M.Sc in Bioinformatics with good academic record. Candidate with experience in database development and scripting would be preferred<br />    Age Limit : Below 28 years<br />    Period : 2 months</p>

<p>Interested candidates may send their applications with bio-data by email (smagarwal@gmail.com) or post addressed to Dr Subhash M Agarwal, Scientist C, Bioinformatics Division, Institute of Cytology and Preventive Oncology (ICPO) I-7, Sector 39, Noida-201301 so as to reach latest by 04.02.14</p>

<p>Deadline : 04.02.14</p>

<p>http://icmr.nic.in/icmrnews/icpo_jrf.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</guid>
	<pubDate>Tue, 08 May 2018 04:52:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</link>
	<title><![CDATA[Metassembler: merging and optimizing de novo genome assemblies]]></title>
	<description><![CDATA[<p><span>Metassembler combines multiple whole genome de novo assemblies into a combined consensus assembly using the best segments of the individual assemblies.</span></p>
<p><span><span>Genome assembly projects typically run multiple algorithms in an attempt to find the single best assembly, although those assemblies often have complementary, if untapped, strengths and weaknesses. We present our metassembler algorithm that merges multiple assemblies of a genome into a single superior sequence.&nbsp;</span></span></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/metassembler/?source=directory" rel="nofollow">https://sourceforge.net/projects/metassembler/?source=directory</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/8385/peng-lab</guid>
  <pubDate>Tue, 18 Feb 2014 13:53:46 -0600</pubDate>
  <link></link>
  <title><![CDATA[Peng Lab]]></title>
  <description><![CDATA[
<p>Peng Lab at Janelia Farm Research Campus, Howard Hughes Medical Institute focuses on data mining for bioinformatics and computational molecular biology, particularly, bioimage data mining and informatics. These bioimages include cellular and molecular images and related medical images. </p>

<p>* Analysis of Gene Expression Pattern Images: high-performance image analysis and mining for different model organisms, such as fruitfly, C. elegans, and mouse;<br />* Feature/Model Learning: developing algorithms and software</p>

<p>Location :Janelia Farm Research Campus, Howard Hughes Medical Institute, Ashburn, Virginia, USA.</p>

<p>http://research.janelia.org/peng/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8442/assistant-professor-king-saud-university-riyadh</guid>
  <pubDate>Fri, 21 Feb 2014 05:57:18 -0600</pubDate>
  <link></link>
  <title><![CDATA[Assistant Professor @ King Saud University Riyadh]]></title>
  <description><![CDATA[
<p>Qualifications: Candidates must have a Ph.D. and a strong background in Molecular and Cellular Biology, protein expression, FACS, or computational biology, and ability to work collaboratively.</p>

<p>This position will have a significant focus on providing analytical support for next generation sequencing data analysis – Exome-sequencing, Targetted sequencing as well as high-throughput genotyping on Illumina platform.</p>

<p>Job location:</p>

<p>Genome Research Chair<br />King Saud University, Riyadh-11451<br />KSA</p>

<p>Interested candidate may forward their CV to grcksu@gmail.com</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8466/srf-position-in-computational-systems-biology-computational-biology-group-iiit-delhi</guid>
  <pubDate>Sun, 23 Feb 2014 20:56:08 -0600</pubDate>
  <link></link>
  <title><![CDATA[SRF position in Computational Systems Biology Computational biology Group, IIIT-Delhi]]></title>
  <description><![CDATA[
<p>An opportunity to perform research in DST supported project that involves building of mathematical models to understand the functional relationship between circadian rhythms and memory formation under stressful condition.  In this project, mathematical model of circadian rhythms based on gene regulatory mechanisms will be unified with the mathematical model of calcium signal transduction pathway to understand and predict the formation of fear memory under stressful conditions. The research scholar will spend full time on this project to build new models and expected to contribute significantly to prepare the results for publication and presentation, and to contribute to grant proposals. </p>

<p>Required Qualifications: Masters in physics/chemistry/mathematics (or) MTech in bioengineering, chemical (or) Masters in any traditional field of science with outstanding performance throughout the program. Candidate should have cleared GATE/UGC-CSIR examinations. Applicant should have done basic mathematics courses like calculus, differential equations, numerical analysis etc in their degree program and have obtained good grades in those courses. Knowledge of MATLAB and C or at least one traditional programming language is absolutely necessary. Strong inclination to understand biological concepts is a must for this research work as this project is about modeling biological systems.     </p>

<p>Salary: A fixed salary of Rs 18000 PM including HRA will be paid. </p>

<p>Last date for application: This advertisement is open until suitable candidate is found for the project. </p>

<p>Preferred Qualifications:  - Expertise in dynamical systems theory, bifurcation theory, numerical simulations, parameter estimation. </p>

<p>Independence and high motivation for carrying out interdisciplinary research. - Excellent communication skills and ability to work independently. - Good working habits. </p>

<p>Interested candidates should submit both curriculum vitae and statement of interest in PDF format to sriramk@iiitd.ac.in and should clearly mention in the subject "Application for SRF".</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</guid>
	<pubDate>Thu, 26 Jul 2018 04:58:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</link>
	<title><![CDATA[My commonly used commands in Bioinformatics]]></title>
	<description><![CDATA[<p>FYI, I've found it useful to use MUMmer to extract the specific changes that Racon makes, so I can evaluate them individually:</p><pre><code>minimap -t 24 assembly.fasta long_reads.fastq.gz | racon -t 24 long_reads.fastq.gz - assembly.fasta racon_assembly.fasta
nucmer -p nucmer assembly.fasta racon_assembly.fasta
show-snps -C -T -r nucmer.delta
</code></pre><p>This reports Racon's changes in a table. You can exclude indels with the&nbsp;<code>-I</code>&nbsp;option in&nbsp;<code>show-snps</code>.&nbsp;</p><p>This process (Racon -&gt; MUMmer -&gt; SNP table) solves the problem I originally raised in this issue. So as far as I'm concerned, you can close this issue (or keep it open if you still want to implement some kind of variant table).</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/12868/landry-lab</guid>
  <pubDate>Thu, 17 Jul 2014 14:33:57 -0500</pubDate>
  <link></link>
  <title><![CDATA[Landry Lab]]></title>
  <description><![CDATA[
<p>EVOLUTIONARY AND INTEGRATIVE CELL BIOLOGY</p>

<p>Our research is at the crossroad between cell biology, ecological genomics, systems biology, molecular evolution and population genetics. We study the architecture and evolution of protein and signalling networks.</p>

<p>More at http://landrylab.ibis.ulaval.ca/</p>
]]></description>
</item>

</channel>
</rss>