Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

For smaller vertebrate genomes (~1 Gbp) chromosome scale assemblies can be achieved within 12h on high-end Desktop computers (Intel i7, 12 CPU threads, 128 GB RAM). Larger mammalian genomes (~3Gbp) can be processed within 15-18 h on server equipment (Xeon, 96 CPU threads, 1TB RAM).

Address of the bookmark: https://github.com/HMPNK/CSA2.6

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Bactopia was inspired by Staphopia, a workflow we (Tim Read and myself) released that is targeted towards Staphylococcus aureus genomes. Using what we learned from Staphopia and user feedback, Bactopia was developed from scratch with usability, portability, and speed in mind from the start.

Bactopia uses Nextflow to manage the workflow, allowing for support of many types of environments (e.g. cluster or cloud). Bactopia allows for the usage of many public datasets as well as your own datasets to further enhance the analysis of your sequencing. Bactopia only uses software packages available from Bioconda and Conda-Forge to make installation as simple as possible for all users.

To highlight the use of Bactopia and Bactopia Tools, we performed an analysis of 1,664 public Lactobacillus genomes, focusing on Lactobacillus crispatus, a species that is a common part of the human vaginal microbiome. The results from this analysis are published in mSystems under the title: Bactopia: a flexible pipeline for complete analysis of bacterial genomes

Address of the bookmark: https://bactopia.github.io/latest/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

https://www.mdpi.com/2073-4425/11/7/756/htm

https://shadowcaster.readthedocs.io/en/latest/

https://github.com/dani2s/ShadowCaster_testData

Address of the bookmark: https://github.com/dani2s/ShadowCaster

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83

Applications are invited from individuals who have high motivation to do research for the below mentioned position,

1. Research Associate - 1 No.
in the DBT sponsored project under the supervision of Dr. D. Prabaharan, Principal Investigator, National Facility for Marine Cyanobacteria, Dept. of Marine Biotechnology, Bharathidasan University, Tiruchirappalli-24.

Title of the Project: “Establishment of National Repository for Micro algae & Cyanobacteria” funded by Department of Biotechnology, Govt. of India

Qualification

1. Research Associate – 1 No. Rs. 36,000/38,000/40,000 per month for I, II and III year + 20% HRA

Essential : Doctoral degree in relevant subject from recognized University/ Institutes
Desirable: Research experience in molecular biology and bioinformatics

Interested candidates can send their complete CV in plain paper with a passport size photograph, with details of Marks secured in all subjects from plus two stage (with proof, full postal address, sex, date of birth, community etc., along with additional qualification or experiences and two address of references whom could be contacted (One of whom should be PG teacher/guide). Application should reach the Principal Investigator on or before 30.06.2015 by Email (nfmcbic@yahoo.com)/Registered post/ Speed post, with subject subscribed as “Application for Research Associate /Technical Assistant /Lab attendant”. Qualifying candidates will be short listed and communicated with date of interview. No TA and DA will be given for attending the interview. Addressfor Communication Dr. D. Prabaharan Principal Investigator National Facility for Marine Cyanobacteria Bharathidasan University Tiruchirappalli-620024, Tamil Nadu.

Advertisement: http://www.bdu.ac.in/adv/NFMC_Project_Positions.pdf

Current research interests include next-generation DNA sequencing, structural variation, genome rearrangements in cancer and evolution, and network analysis of somatic mutations in cancer. Earlier research included topics in comparative genomics, multiple sequence alignment, and motif finding.

More athttp://compbio.cs.brown.edu/