<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30149?offset=1070</link>
	<atom:link href="https://bioinformaticsonline.com/related/30149?offset=1070" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/11311/stephen-friend-the-hunt-for-unexpected-genetic-heroes</guid>
	<pubDate>Sat, 31 May 2014 14:31:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/11311/stephen-friend-the-hunt-for-unexpected-genetic-heroes</link>
	<title><![CDATA[Stephen Friend: The hunt for "unexpected genetic heroes"]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/Yagdvqn2YMU" frameborder="0" allowfullscreen></iframe>What can we learn from people with the genetics to get sick — who don't? With most inherited diseases, only some family members will develop the disease, while others who carry the same genetic risks dodge it. Stephen Friend suggests we start studying those family members who stay healthy. Hear about the Resilience Project, a massive effort to collect genetic materials that may help decode inherited disorders.

TEDTalks is a daily video podcast of the best talks and performances from the TED Conference, where the world's leading thinkers and doers give the talk of their lives in 18 minutes (or less). Look for talks on Technology, Entertainment and Design -- plus science, business, global issues, the arts and much more.
Find closed captions and translated subtitles in many languages at http://www.ted.com/translate

Follow TED news on Twitter: http://www.twitter.com/tednews
Like TED on Facebook: https://www.facebook.com/TED

Subscribe to our channel: http://www.youtube.com/user/TEDtalksDirector]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12896/inspire-faculty-scheme-a-component-of-%E2%80%9Cassured-opportunity-for-research-career-aorc%E2%80%9D-under-inspire</guid>
  <pubDate>Sat, 19 Jul 2014 14:59:30 -0500</pubDate>
  <link></link>
  <title><![CDATA[INSPIRE Faculty Scheme: a component of “Assured Opportunity for Research Career (AORC)” under INSPIRE.]]></title>
  <description><![CDATA[
<p>Ministry of Science and Technology, Department of Science and Technology</p>

<p>7th ADVERTISEMENT – 2014 (2)</p>

<p>INSPIRE Faculty Scheme: a component of “Assured Opportunity for Research Career (AORC)” under INSPIRE.</p>

<p>The Department of Science and Technology, Government of India, has launched the “Innovation in Science Pursuit for Inspired Research (INSPIRE)” [http://www.inspire-dst.gov.in] program in 2008.</p>

<p>The program aims to attract talent for study of science and careers with research. INSPIRE includes many components. The importance of Assured Career Opportunity in R&amp;D sector has been recognized.</p>

<p>INSPIRE Faculty Scheme opens up an “Assured Opportunity for Research Career (AORC)” for young researchers in the age group of 27-32 years. It offers a contractual research awards to young achievers and opportunity for independent research in the near term and emerge as a future leader in the long term.</p>

<p>Eligibility</p>

<p>Essential Indian citizens and people of Indian origin including NRI/PIO status with PhD (in science, mathematics, engineering, pharmacy, medicine, and agriculture related subjects) from any recognized university in the world,</p>

<p>Those who have submitted their PhD Theses and are awaiting award of the degree are also<br />eligible. However, the award will be conveyed only after confirmation of the awarding the<br />PhD degree.</p>

<p>The upper age limit as on 1st July 2014 should be 32 years for considering support for a<br />period of 5 years. However, for SC and ST candidates, upper age limit will be 35 years.</p>

<p>Publication(s) in highly reputed Journals demonstrating research potential of the candidate.</p>

<p>Desirable</p>

<p>Candidates who are within top 1% at the School Leaving Examination, IIT-JEE rank, 1st Rank Holder either in graduation or post-graduation level university examination (which are used presently for identifying INSPIRE Scholars at under-graduate level and INSPIRE Fellows for doctoral degree)</p>

<p>More at http://www.inspire-dst.gov.in/faculty_scheme.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</guid>
	<pubDate>Thu, 14 May 2020 15:09:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</link>
	<title><![CDATA[LR_Gapcloser: a tiling path-based gap closer that uses long reads to complete genome assembly]]></title>
	<description><![CDATA[<p>LR_Gapcloser is a gap closing tool using long reads from studied species. The long reads could be downloaed from public read archive database (for instance, NCBI SRA database ) or be your own data. Then they are fragmented and aligned to scaffolds using BWA mem algorithm in BWA package. In the package, we provided a compiled bwa, so the user needn't to install bwa. LR_Gapcloser uses the alignments to find the bridging that cross the gap, and then fills the long read original sequence into the genomic gaps.</p><p>Address of the bookmark: <a href="https://github.com/CAFS-bioinformatics/LR_Gapcloser" rel="nofollow">https://github.com/CAFS-bioinformatics/LR_Gapcloser</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/11603/ncbi-webinar</guid>
	<pubDate>Sun, 08 Jun 2014 02:47:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/11603/ncbi-webinar</link>
	<title><![CDATA[NCBI Webinar]]></title>
	<description><![CDATA[<p>In less than two weeks, NCBI will offer a webinar entitled "Introducing 3 NCBI Resources to Navigate Testing for Disease Linked Variants: MedGen, GTR and ClinVar". This webinar will delve into the lifecycle of genetic testing and teach attendees how to navigate the NIH Genetic Testing Registry, ClinVar, and MedGen resources. These resources can be used to prepare for clinical cases, access detailed information about orderable genetic tests, interpret test results, and more.</p><p>More at https://attendee.gotowebinar.com/register/8452228815737989634</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37840/long-read-assembly-workshop</guid>
	<pubDate>Thu, 04 Oct 2018 17:23:18 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37840/long-read-assembly-workshop</link>
	<title><![CDATA[Long read assembly workshop !]]></title>
	<description><![CDATA[<p>This is a tutorial for a workshop on long-read (PacBio) genome assembly.</p>
<p>It demonstrates how to use long PacBio sequencing reads to assemble a bacterial genome, and includes additional steps for circularising, trimming, finding plasmids, and correcting the assembly with short-read Illumina data.</p>
<p>&nbsp;Please comment if you know any other long read addembly tutorial.</p><p>Address of the bookmark: <a href="http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/" rel="nofollow">http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12111/internship-program-with-arraygen-technolgies</guid>
  <pubDate>Sun, 22 Jun 2014 23:18:31 -0500</pubDate>
  <link></link>
  <title><![CDATA[Internship program with ArrayGen Technolgies]]></title>
  <description><![CDATA[
<p>Internship Program for Bioinformatics / Biotechnology Professionals Currently we offer positions to outstanding students interested in Next Generation Sequencing (NGS) data analysis. Applications are accepted throughout the year. Accepted students will be listed on web with their schedules. Accepted students can attend our future workshops and trainings freely at the specified venue.</p>

<p>Interested candidates may email their resume along with a cover letter to careers@arraygen.com</p>

<p>Official website: http://www.arraygen.com/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38053/swgis-v20-a-seqword-genomic-island-sniffer</guid>
	<pubDate>Thu, 01 Nov 2018 12:35:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38053/swgis-v20-a-seqword-genomic-island-sniffer</link>
	<title><![CDATA[swgis v2.0 : a seqword genomic island sniffer]]></title>
	<description><![CDATA[<p><strong>swgis v2.0</strong>&nbsp;is the modified version of the seqword genomic island sniffer. this version is specifically optimized for predicting genomic islands in eukaryotic genomes. swgis v2.0 was tested on several eukaryotic species of different lineages. all identified genomic islands were deposited in the&nbsp;<a href="http://eugi.bi.up.ac.za/" title="Go to EuGI database">eugi database</a>.</p>
<p><a href="http://eugi.bi.up.ac.za/download_swgis/swgisv2.0.zip" title="Download SWGIS v2.0">download swgis v2.0</a></p><p>Address of the bookmark: <a href="http://eugi.bi.up.ac.za/eugi_download_swgis.php" rel="nofollow">http://eugi.bi.up.ac.za/eugi_download_swgis.php</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12566/jrf-at-national-research-centre-on-plant-biotechnology</guid>
  <pubDate>Fri, 04 Jul 2014 13:36:02 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF at NATIONAL RESEARCH CENTRE ON PLANT BIOTECHNOLOGY]]></title>
  <description><![CDATA[
<p>NATIONAL RESEARCH CENTRE ON PLANT BIOTECHNOLOGY</p>

<p>New Delhi-110012</p>

<p>Walk in interview</p>

<p>Eligible candidates may appear for Walk-in interview for the temporary positions of JRF/SRF/ RA, in ICAR, DBT funded research projects. Positions are purely temporary in nature and are co-terminus with the projects. The initial appointment will be for maximum one year, which can be extended on the basis of assessment of the candidate performance and need in the project work (PI-Dr. N. K. Singh, National Professor).</p>

<p>Name of the</p>

<p>PI (Project)<br />	</p>

<p>Name of</p>

<p>Position<br />	</p>

<p>Number of</p>

<p>positions<br />	</p>

<p>Emoluments</p>

<p>Fixed per</p>

<p>month (Rs.)<br />	</p>

<p>Essential</p>

<p>Qualifications</p>

<p>DBT-“Physical Mapping and Sample sequencing of Wheat Chromosome 2A- International Wheat Genome Sequencing Consortium (India)”.</p>

<p>(Up to Nov,2014)</p>

<p>DBT- Identification and functional analysis of genes related to yield and biotic stresses (Up to Oct,2014)</p>

<p>NPTC-Central Facility<br />	</p>

<p>RA (Master)</p>

<p>JRF/SRF</p>

<p>Research Associate: One</p>

<p>Essential: MCA or M. Tech. (Bioinformatics and computer Science with 2 years experience in Database Management with</p>

<p>MySQL, Linux)</p>

<p>Desirable: Proficiency in handling of large biological databases</p>

<p>Age limit: Max. Age 35 years (Age of relaxation of 5 years for SC/ST&amp; woman. and 3 years for OBC). The interview will be held on 08 July, 2014 at 11 am at room no. 39, NRCPB, LBS Building, Pusa Campus, New Delhi-110012. The candidates must bring original certificates and four copies of biodata, and recent passport size photograph. No TA/DA would be given for the appearance in interview. Only the candidates having essential qualifications would be entertained for the interviews.</p>

<p>Advertisement:</p>

<p>www.nrcpb.org/sites/default/files/news%20paper%20advirtisment..docx</p>
]]></description>
</item>

</channel>
</rss>