If you are interested in gene prediction, have a look at GenomeThreader.

Address of the bookmark: http://genometools.org/

ICRISAT seeks applications from Indian nationals Visiting Scientist-Computational Genomics (2 positions), to be part of a team of Centre of Excellence in Genomics (CEG), (www.icrisat.org/ceg) to work on legume genomics projects. The positions will be based at ICRISAT’s Headquarters in Patancheru, Hyderabad, India.

ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these are the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture. ICRISAT is headquartered in Greater Hyderabad, Andhra Pradesh, India and belongs to the Consortium of Centers supported by the Consultative Group on International Agricultural Research (CGIAR).

The Job: Responsibilities for these positions include:

Analyzing and handling large-scale next generation sequencing DNA and RNA data
Data mining and development of pipelines and troubleshooting
Genome diversity analysis such as SNPs, Indels, Structural Variations, population structure
Genome wide association study (GWAS) related analysis- LD analysis, hapmap and trait mapping
Expression analysis based on RNA-Seq data, annotation, gene ontology and metabolic pathway analysis
Epigenome analysis, small RNA identification
Gene family analysis, sequence level protein analysis, orthology/paralogy and molecular modelling
Compiling and analysis of results, writing reports and research papers

The Person: Ph.D. or MSc/MTech/PGDCA with two years research experience in Biotechnology, Computational biology, Agricultural/ Plant Biotechnology, Genetics, Molecular Biology or related discipline. Good knowledge of programming/scripting in at least two of following languages: Perl, C, C++, R, Shell Scripting and Python is plus.

How to apply: Please apply latest by 20 July 2014. The application should include the name of the position applied for, a letter of motivation, a full Curriculum Vita (CV), and the names and contact information of three references that are knowledgeable of the candidate’s professional qualifications and work experience. Technical details and more information about these positions can be obtained from R.K.VARSHNEY@CGIAR.ORG. All applications will be acknowledged, however only short listed candidates will be contacted.

Apply here https://recruit.zoho.com/ats/Portal.na?digest=T642sgLYWZOStExJ77cPrcM*sIMGZETWw4yPxngbmHA-

Using AlignGraph

AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]

Address of the bookmark: https://github.com/baoe/AlignGraph

Address of the bookmark: http://www.programmingr.com/category/stype/r-job-listings/

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

7th ADVERTISEMENT – 2014 (2)

INSPIRE Faculty Scheme: a component of “Assured Opportunity for Research Career (AORC)” under INSPIRE.

The Department of Science and Technology, Government of India, has launched the “Innovation in Science Pursuit for Inspired Research (INSPIRE)” [http://www.inspire-dst.gov.in] program in 2008.

The program aims to attract talent for study of science and careers with research. INSPIRE includes many components. The importance of Assured Career Opportunity in R&D sector has been recognized.

INSPIRE Faculty Scheme opens up an “Assured Opportunity for Research Career (AORC)” for young researchers in the age group of 27-32 years. It offers a contractual research awards to young achievers and opportunity for independent research in the near term and emerge as a future leader in the long term.

Eligibility

Essential Indian citizens and people of Indian origin including NRI/PIO status with PhD (in science, mathematics, engineering, pharmacy, medicine, and agriculture related subjects) from any recognized university in the world,

Those who have submitted their PhD Theses and are awaiting award of the degree are also
eligible. However, the award will be conveyed only after confirmation of the awarding the
PhD degree.

The upper age limit as on 1st July 2014 should be 32 years for considering support for a
period of 5 years. However, for SC and ST candidates, upper age limit will be 35 years.

Publication(s) in highly reputed Journals demonstrating research potential of the candidate.

Desirable

Candidates who are within top 1% at the School Leaving Examination, IIT-JEE rank, 1st Rank Holder either in graduation or post-graduation level university examination (which are used presently for identifying INSPIRE Scholars at under-graduate level and INSPIRE Fellows for doctoral degree)

More at http://www.inspire-dst.gov.in/faculty_scheme.html

This script has been modified by others to convert InDels as well, e.g. this by David Eccles

./vcf2fq.pl -f <input.fasta> <all-site.vcf> > <output.fastq>

https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl

https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl