BOL: Related items

AliTV—interactive visualization of whole genome comparisons

Jit — Wed, 10 Jan 2018 07:08:17 -0600

AliTV, which provides interactive visualization of whole genome alignments. AliTV reads multiple whole genome alignments or automatically generates alignments from the provided data. Optional feature annotations and phylo- genetic information are supported. The user-friendly, web-browser based and highly customizable interface allows rapid exploration and manipulation of the visualized data as well as the export of publication-ready high-quality figures. AliTV is freely available at https://github.com/AliTVTeam/AliTV

https://alitvteam.github.io/AliTV/

Address of the bookmark: https://github.com/AliTVTeam/AliTV

Managing and Analyzing Next-Generation Sequence Data

Rahul Agarwal — Sat, 10 May 2014 06:28:06 -0500

Centralized Bioinformatics Core Facilities provide shared resources for the computational and IT requirements of the investigators in their department or institution. As such, they must be able to effectively react to new types of experimental technology. Recently faced with an unprecedented flood of data generated by the next generation of DNA sequencers, these groups found it necessary to respond quickly and efficiently to the informatics and infrastructure demands. Centralized Facilities newly facing this challenge need to anticipate time and design considerations of necessary components, including infrastructure upgrades, staffing, and tools for data analyses and management ...

More at http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1000369

Address of the bookmark: http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1000369

GenomeTools: The versatile open source genome analysis software

Jit — Wed, 07 Feb 2018 10:44:18 -0600

The GenomeTools genome analysis system is a free collection of bioinformatics tools (in the realm of genome informatics) combined into a single binary named gt. It is based on a C library named “libgenometools” which consists of several modules.

If you are interested in gene prediction, have a look at GenomeThreader.

Address of the bookmark: http://genometools.org/

Visiting Scientist - Computational Genomics (two positions)

Mon, 07 Jul 2014 22:53:41 -0500

Scientific/Managerial & International Recruitment

ICRISAT seeks applications from Indian nationals Visiting Scientist-Computational Genomics (2 positions), to be part of a team of Centre of Excellence in Genomics (CEG), (www.icrisat.org/ceg) to work on legume genomics projects. The positions will be based at ICRISAT’s Headquarters in Patancheru, Hyderabad, India.

ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these are the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture. ICRISAT is headquartered in Greater Hyderabad, Andhra Pradesh, India and belongs to the Consortium of Centers supported by the Consultative Group on International Agricultural Research (CGIAR).

The Job: Responsibilities for these positions include:

Analyzing and handling large-scale next generation sequencing DNA and RNA data
Data mining and development of pipelines and troubleshooting
Genome diversity analysis such as SNPs, Indels, Structural Variations, population structure
Genome wide association study (GWAS) related analysis- LD analysis, hapmap and trait mapping
Expression analysis based on RNA-Seq data, annotation, gene ontology and metabolic pathway analysis
Epigenome analysis, small RNA identification
Gene family analysis, sequence level protein analysis, orthology/paralogy and molecular modelling
Compiling and analysis of results, writing reports and research papers

The Person: Ph.D. or MSc/MTech/PGDCA with two years research experience in Biotechnology, Computational biology, Agricultural/ Plant Biotechnology, Genetics, Molecular Biology or related discipline. Good knowledge of programming/scripting in at least two of following languages: Perl, C, C++, R, Shell Scripting and Python is plus.

How to apply: Please apply latest by 20 July 2014. The application should include the name of the position applied for, a letter of motivation, a full Curriculum Vita (CV), and the names and contact information of three references that are knowledgeable of the candidate’s professional qualifications and work experience. Technical details and more information about these positions can be obtained from R.K.VARSHNEY@CGIAR.ORG. All applications will be acknowledged, however only short listed candidates will be contacted.

Apply here https://recruit.zoho.com/ats/Portal.na?digest=T642sgLYWZOStExJ77cPrcM*sIMGZETWw4yPxngbmHA-

AlignGraph: algorithm for secondary de novo genome assembly guided by closely related references

Manisha Mishra — Tue, 17 Apr 2018 16:21:20 -0500

AlignGraph is a software that extends and joins contigs or scaffolds by reassembling them with help provided by a reference genome of a closely related organism.

Using AlignGraph

AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]

Address of the bookmark: https://github.com/baoe/AlignGraph

R programming and Jobs website

Pragati Singh — Sun, 25 May 2014 14:43:57 -0500

Welcome to the R Jobs section of ProgrammingR.com. If your organization has an R employment opportunity that you would like to have posted here, submit it via the contact page. Prospective employees: use the contact information provided in the position listing to apply or contact the hiring organization.

Address of the bookmark: http://www.programmingr.com/category/stype/r-job-listings/

CrossMap: a program for convenient conversion of genome coordinates

Jit — Thu, 31 May 2018 06:00:47 -0500

CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) <> hg19 (GRCh37), Mouse mm9 (MGSCv37) <> mm10 (GRCm38)). It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF. CrossMap is designed to liftover genome coordinates between assemblies. It’s not a program for aligning sequences to reference genome. We do not recommend using CrossMap to convert genome coordinates between species.

Address of the bookmark: http://crossmap.sourceforge.net

assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome

Jit — Thu, 14 Jun 2018 07:31:00 -0500

Download and install MUMmer Align your assembly to a reference genome using nucmer (from MUMmer package) $ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT Consult the MUMmer manual if you encounter problems Optional: Gzip the delta file to speed up upload (usually 2-4X faster) $ gzip OUT.delta Then use the OUT.delta.gz file for upload. Upload the .delta or delta.gz file (view example) to Assemblytics Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference. The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment. http://assemblytics.com/

Address of the bookmark: http://assemblytics.com/

Stephen Friend: The hunt for "unexpected genetic heroes"

Sat, 31 May 2014 14:31:47 -0500

What can we learn from people with the genetics to get sick — who don't? With most inherited diseases, only some family members will develop the disease, while others who carry the same genetic risks dodge it. Stephen Friend suggests we start studying those family members who stay healthy. Hear about the Resilience Project, a massive effort to collect genetic materials that may help decode inherited disorders. TEDTalks is a daily video podcast of the best talks and performances from the TED Conference, where the world's leading thinkers and doers give the talk of their lives in 18 minutes (or less). Look for talks on Technology, Entertainment and Design -- plus science, business, global issues, the arts and much more. Find closed captions and translated subtitles in many languages at http://www.ted.com/translate Follow TED news on Twitter: http://www.twitter.com/tednews Like TED on Facebook: https://www.facebook.com/TED Subscribe to our channel: http://www.youtube.com/user/TEDtalksDirector

LINKS scaffolder bloomfilter setting !

Jit — Fri, 15 Jun 2018 10:39:54 -0500

➜ bin git:(master) ✗ ls -l
total 68
drwxrwxr-x 3 urbe urbe 4096 Jun 15 12:15 lib
-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS
➜ bin git:(master) ✗ pwd
/home/urbe/Tools/LINKS_1.8.6/bin

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr