1. 2 Eggs and 100 Floor Classic Puzzle
2. Five pirates and gold coin Puzzle
3. Six pirates and Gold Coin puzzle
4. Probability of having boy
5. Random Airplane Seats
6. Inverted playing card puzzle
7. Flipping Coins Puzzle
8. Three hat colors Microsoft Puzzle
9. 25 horses 5 tracks Puzzle
10. Gold Bar Puzzle
11. Crossing the Bridge Puzzle
12. Will you accept the bet?
13. The Puzzle of 100 Hats
14. Man fell in Well Puzzle
15. Minimum Number of Weigths
16. One Bulb with 3 Switches
17. Find the minimum number of aircraft
18. Burning ropes to measure time
19. Connect 3 houses with 3 wells
20. Measure 9 minutes from 2 hourglasses puzzle
21. Ant and Triangle Problem
22. The Man in the Elevator
23. Find the survivor
24. Free the prisoners puzzle
25. GREAT STRATEGY CAN ONLY SAVE LIFE

Specially for Microsoft Interview Puzzles, you may refer,
Top 15 Microsoft Interview Puzzles
Microsoft Interview Puzzles

Other MOST COMMON Interview Puzzles-
Top 25 Tech Interview Logical Puzzles

Each of the puzzles got repeated a number of times in interviews even for top tech companies 

Address of the bookmark: https://github.com/lmcai/PhyloHerb/

4 Programme Officer 1
5 Technical Research Assistant 1

Minimum Educational Qualification, desirable experience and expected duties:

4: The applicants should be Postgraduates with experience in Data collection and Statistics, especially in Biotechnology-related data.

Expected duties: Collection of Biotechnology related information from India, to facilitate the Apex BTIC experts committee review of programmes at centres and R&D programs funded by DBT.

5: The applicants should be Postgraduates in Science with experience in Bioinformatics-related projects.
Expected duties: The candidates will assist the senior staff of the centre in daily activities and help in the preparation of the Annual Training Calendar, seminar and training podcasts/videos, repository of training material and Apex BTIC Newsletter.

Interested candidates should submit their full, updated Curriculum Vitae with a detailed description of relevant experience, along with two references by December 14th, 2018, addressed to, The Chairperson, DBT- Apex BTIC, ICGEB, Aruna Asaf Ali Marg, New Delhi 110067, Email: abtic@icgeb.res.in, kindly write “Application for DBT Apex BTIC vacancy” in the subject of the email or envelope, if sending by post.

Advertisement: http://www.icgeb.org/tl_files/Vacancies/dbt-abtic-vac-annmntrevsk.pdf

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

a) Show appreciation for their time and thank them

b) Mention something specific you talked about in the interview, so they know it’s not a cut & paste email

c) Express interest in the position and tell them you’re excited to learn more

d) Invite them to contact you if they have any questions/concerns, or need clarification on anything discussed

First sample:

Dear Dr XYZ
I enjoyed speaking with you today about the XXX position at the X Lab, Uni. The job seems to be an excellent match for my skills and interests.

The lab loaded with new updated technology and international experts, that you informed while interviewing confirmed my desire to work with X lab.

In addition to my enthusiasm, I will bring to the position strong writing skills, assertiveness, and the ability to encourage others to work cooperatively with the group

I appreciate the time you took to interview me. I am very interested in working with you and look forward to hearing from you regarding this position.

Sincerely,
XXX

Second sample:

Dear Dr XXX,

I wanted to take a second to thank you for your time . I enjoyed our conversation about and enjoyed learning about the position overall.

It sounds like an exciting opportunity, and an opportunity I could succeed and excel in! I’m looking forward to hearing any updates you can share, and don’t hesitate to contact me if you have any questions or concerns in the meantime.

Thanks again for the great conversation .

Best Regards,
XXX

kallisto

RASA offers faster, better and cost effective cutting edge technology solutions to chemical and life science research and industry. We provide our customers with A seamless model of wide expertise and comprehensive platforms. Our Value is to take our customers

Address of the bookmark: https://github.com/reubwn/hgt

1. https://www.ulster.ac.uk/doctoralcollege/find-a-phd/510894
2. https://www.ulster.ac.uk/doctoralcollege/find-a-phd/511458
3. https://www.ulster.ac.uk/doctoralcollege/find-a-phd/512618

Looking for students with good computational/programming skills (preferable in Linux/Shell, Python and/or R) and knowledge in computational biology and statistics. However, students from more biology oriented background but strong interest to learn bioinformatics and programming are also encouraged to apply.

Informal inquiries are welcomed at: p.shukla@ulster.ac.uk

Dr Priyank Shukla PhD FHEA FCHERP
Lecturer (Asst Prof) in Stratified Medicine (Bioinformatics)

Northern Ireland Centre for Stratified Medicine
Biomedical Sciences Research Institute
University of Ulster (Magee Campus)
C-TRIC Building, Altnagelvin Area Hospital
Glenshane Road, Derry/Londonderry
BT47 6SB, Northern Ireland, United Kingdom

T: +44 28 7167 5690
E: p.shukla@ulster.ac.uk
W: https://www.ulster.ac.uk/staff/p-shukla

https://www.nature.com/articles/nmeth.4556

Address of the bookmark: https://github.com/ryanlayer/giggle