<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30203?offset=370</link>
	<atom:link href="https://bioinformaticsonline.com/related/30203?offset=370" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39875/lrsday-long-read-sequencing-data-analysis-for-yeasts</guid>
	<pubDate>Mon, 26 Aug 2019 18:07:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39875/lrsday-long-read-sequencing-data-analysis-for-yeasts</link>
	<title><![CDATA[LRSDAY: Long-read Sequencing Data Analysis for Yeasts]]></title>
	<description><![CDATA[<p><span>Long-read sequencing technologies have become increasingly popular in genome projects due to their strengths in resolving complex genomic regions. As a leading model organism with small genome size and great biotechnological importance, the budding yeast,&nbsp;</span><em>Saccharomyces cerevisiae</em><span>, has many isolates currently being sequenced with long reads.&nbsp;</span></p><p>Address of the bookmark: <a href="https://github.com/yjx1217/LRSDAY" rel="nofollow">https://github.com/yjx1217/LRSDAY</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36197/bioinformatics-oneliner</guid>
	<pubDate>Tue, 10 Apr 2018 04:13:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36197/bioinformatics-oneliner</link>
	<title><![CDATA[Bioinformatics OneLiner]]></title>
	<description><![CDATA[<p>To remove all line ends (\n) from a Unix text file:</p><pre>sed ':a;N;$!ba;s/\n//g' filename.txt &gt; newfilename_oneline.txt</pre><p>To get average for a column of numbers (here the second column $2):</p><pre>awk '{ sum += $2; n++ } END { if (n &gt; 0) print sum / n; }'</pre><p>To get sequence length for all sequences in a fasta file:</p><pre>awk '/^&gt;/ {if (seqlen){print seqlen}; print ;seqlen=0;next; } { seqlen = seqlen +length($0)}END{print seqlen}' \<br />filename.fasta</pre><p>To copy (move, rename, etc) files based on their list in a text file:</p><pre>cat file_list.txt | while read line; do cp "$line" complete_dataset/"$line"; done</pre><p>To split bam files into sets with mapped and unmapped reads:</p><pre>samtools view -F4 sample.bam &gt; sample.mapped.sam<br />samtools view -f4 sample.bam &gt; sample.unmapped.sam</pre><p>To gzip all your fastq files using gnu parallel and gzip:</p><pre>parallel gzip ::: *.fastq</pre><p>To gzip all your fastq files using pigz:</p><pre>pigz *.fastq</pre><p>To count all sequences in a fasta file:</p><pre>grep "^&gt;" yourfile.fasta -c</pre><p>To count all sequences in all fasta files in your current directory:</p><pre>for a in *.fasta; do ls $a; grep "^&gt;" -c $a; done</pre><p>To keep only one copy of duplicated lines:</p><pre>awk '!seen[$0]++'</pre><p>To sum assembly size from SPAdes contigs.fasta or scaffolds.fasta file:</p><pre>grep "^&gt;" scaffolds.fasta | cut -f 4 -d '_' | paste -sd+ | bc</pre><p>To remove everything after the first space at each line, e.g. to to simplify fasta headers:</p><pre>cut -d' ' -f1 &lt; your_file</pre><p>To count reads in a all .fastq.gz files in your current folder (fast, using gnu parallel):</p><pre>parallel "echo {} &amp;&amp; gunzip -c {} | wc -l | awk '{d=\$1; print d/4;}'" ::: *.gz</pre><p>To count reads in a all .fastq.gz files in your current folder:</p><pre>zcat *.gz | echo $((`wc -l`/4))</pre><p>To count reads in a all .fastq files in your current folder:</p><pre>cat *.fastq | echo $((`wc -l`/4))</pre><p>To count base pairs in a all .fastq.gz files in your current folder:</p><pre>zcat *.fastq.gz | paste - - - - | cut -f 2 | tr -d '\n' | wc -c </pre><p>To split multifasta file into many fasta files:</p><pre>awk '/^&gt;/ {OUT=substr($0,2) ".fa"}; {print &gt;&gt; OUT; close(OUT)}' Input_File</pre><p>To convert Illumina FASTQ 1.3 to 1.8:</p><pre>sed -e '4~4y/@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\\]^_`abcdefghi/!"#$%&amp;'\''()*+,-.\/0123456789:;&lt;=&gt;?@ABCDEFGHIJ/' f.fastq</pre><p>To convert FASTQ to FASTA:</p><pre>sed -n '1~4s/^@/&gt;/p;2~4p' </pre><p>To get fastq read length distribution:</p><pre>cat reads.fastq | awk '{if(NR%4==2) print length($1)}' | sort | uniq -c</pre><p>To deinterleave interleaved fastq file:</p><pre>cat myf.fq | paste - - - - - - - - | tee &gt;(cut -f 1-4 | tr "\t" "\n" &gt; myfile_1.fq) | cut -f 5-8 | \<br />tr "\t" "\n" &gt; myf2.fq </pre><p>To filter and sort contig identifiers from SPAdes assembly (e.g. here lenght &gt;= 4000 + coverage &gt;=100):</p><pre>grep "^&gt;" scaffolds.fasta | sed s"/_/ /"g | awk '{ if ($4 &gt;= 4000 &amp;&amp; $6 &gt;= 100) print $0 }' | sort -k 4 -n | \<br />sed s"/ /_/"g</pre><p>To append something to all headers of your fasta files:</p><pre>sed 's/&gt;.*/&amp;YOURSTRING/' filename.fasta &gt; new_filename.fasta</pre><p>To replace/squeeze multiple adjacent spaces by only one space:&nbsp;</p><pre>tr -s " " &lt; file</pre><p>To filter fastq based on length (here larger than or equal to 21, but smaller than or equal to 25.</p><pre>cat your.fastq | paste - - - - | awk 'length($2)&nbsp; &gt;= 21 &amp;&amp; length($2) &lt;= 25' | sed 's/\t/\n/g' &gt; filtered.fastq</pre><p>To print difference between the last and first row in 5th column:</p><pre>awk '{if (!first){first=$5;}; last=$5;} END {print last-first}' myfile.txt</pre><p>To sample only 200 first bases from all sequences in a multifasta file (e.g. from assembly scaffolds.fasta file here):</p><pre>awk '/^&gt;/{ seqlen=0; print; next; } seqlen &lt; 200 { if (seqlen + length($0) &gt; 200) $0 = substr($0, 1, 200-seqlen);\<br /> seqlen += length($0); print }' scaffolds.fasta &gt; 200bp_scaffolds.fasta</pre><p>&nbsp;To pipe a compressed fasta file directly into makeblastdb.</p><pre>gunzip -c fasta.gz | makeblastdb -in -</pre><p>To remove sequences with duplicate fasta headers from a fasta file.</p><pre>awk '/^&gt;/{f=!d[$1];d[$1]=1}f' in.fasta &gt; out.fasta</pre>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</guid>
	<pubDate>Sun, 20 Dec 2020 11:43:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</link>
	<title><![CDATA[BioJupies: Automatically Generates RNA-seq Data Analysis Notebooks]]></title>
	<description><![CDATA[<p>With BioJupies you can produce in seconds a customized, reusable, and interactive report from your own raw or processed RNA-seq data through a simple user interface</p>
<p>BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.</p><p>Address of the bookmark: <a href="https://amp.pharm.mssm.edu/biojupies/" rel="nofollow">https://amp.pharm.mssm.edu/biojupies/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36384/binding-site-prediction-in-protein</guid>
	<pubDate>Wed, 25 Apr 2018 04:35:57 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36384/binding-site-prediction-in-protein</link>
	<title><![CDATA[Binding Site Prediction in Protein !]]></title>
	<description><![CDATA[<p><span>The interaction between proteins and other molecules is fundamental to all biological functions. In this section we include tools that can assist in prediction of interaction sites on protein surface and tools for predicting the structure of the intermolecular complex formed between two or more molecules (docking).</span></p><h4>Pockets Identification</h4><p><a href="http://sts.bioengr.uic.edu/castp/" target="_blank">CASTp</a></p><div style="text-align: justify;">Automatic Identification of pockets and cavities in proteins structure, and quantitation of their volumes using Delaunay triangulation. Available also as PyMOL plugin</div><p><a href="http://www.bioinformatics.leeds.ac.uk/pocketfinder/" target="_blank">Pocket-Finder</a></p><div style="text-align: justify;">Automatic identification of pockets and cavities in proteins structure, and quantitation of their volumes.</div><p><a href="http://gecco.org.chemie.uni-frankfurt.de/pocketpicker/index.html" target="_blank">PocketPicker</a></p><div style="text-align: justify;">Grid-based technique for the analysis of protein pockets. PocketPicker available as a plugin for&nbsp;<a href="https://bip.weizmann.ac.il/toolbox/structure/pymol.htm">PyMOL</a></div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;"><h4>Binding Site Prediction</h4>
<p><a href="http://consurf.tau.ac.il/" target="_blank">ConSurf</a></p>
</div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;">Identification of functional regions in proteins by surface-mapping of phylogenetic information</div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;"><a href="http://www-cryst.bioc.cam.ac.uk/~crescendo/crescendo.php" target="_blank">CRESCENDO</a></div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;">Identification protein interaction sites. It uses sequence conservation patterns in homologous proteins to distinguish between residues that are conserved due to structural restraints from those due to functional restraints.&nbsp;&nbsp;</div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;"><strong>Ligand Binding Sites</strong></div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;"><a href="http://www.sbg.bio.ic.ac.uk/~3dligandsite/" target="_blank">3DLigandSite</a></div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;">The server utilizes protein-structure prediction to provide structural models of the binding site. Ligands bound to structures are superimposed onto the model and use to predict the binding site.</div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;">F<a href="http://cssb.biology.gatech.edu/skolnick/files/FINDSITE/" target="_blank">INDSITE</a></div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;">A threading-based method for ligand-binding site prediction and functional annotation based on binding-site similarity across superimposed groups of threading templates.</div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;">
<p><a href="http://scoppi.biotec.tu-dresden.de/pocket/" target="_blank">LIGSITE<sup>csc</sup></a></p>
<div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;">Prediction of binding site by pocket identification using the Connolly surface and degree of conservation</div>
<p><a href="http://metapocket.eml.org/" target="_blank"></a></p>
</div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;"><a href="http://metapocket.eml.org/" target="_blank">metaPocket</a>A meta server for ligand-binding site prediction. metaPocket use&nbsp;<a href="https://bip.weizmann.ac.il/toolbox/structure/binding.htm#ligsite">LIGSITE<sup>csc</sup></a>,&nbsp;<a href="https://bip.weizmann.ac.il/toolbox/structure/binding.htm#pass">PASS</a>,&nbsp;<a href="https://bip.weizmann.ac.il/toolbox/structure/binding.htm#qsite">Q-SiteFinder</a>&nbsp;and&nbsp;<a href="http://www.biochem.ucl.ac.uk/~roman/surfnet/surfnet.html" target="_blank">SURFNET</a></div>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44470/phyloherb-phylogenomic-analysis-pipeline-for-herbarium-specimens</guid>
	<pubDate>Wed, 21 Feb 2024 06:15:13 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44470/phyloherb-phylogenomic-analysis-pipeline-for-herbarium-specimens</link>
	<title><![CDATA[PhyloHerb: Phylogenomic Analysis Pipeline for Herbarium Specimens]]></title>
	<description><![CDATA[<p><span>What is PhyloHerb</span><span>: PhyloHerb is a wrapper program to process&nbsp;</span><span>genome skimming</span><span>&nbsp;data collected from plant materials. The outcomes include the plastid genome (plastome) assemblies, mitochondrial genome assemblies, nuclear ribosomal DNAs (NTS+ETS+18S+ITS1+5.8S+ITS2+28S), alignments of gene and intergenic regions, and a species tree. It is designed to be a high throughput program dealing with lower quality data. Examples include&nbsp;</span><span>low-coverage (5x cpDNA) plastome phylogeny, recycling plastid genes from target enrichment data, retrieving low-copy nuclear genes from medium coverage (5x nucDNA) genome skimming</span><span>.</span></p><p>Address of the bookmark: <a href="https://github.com/lmcai/PhyloHerb/" rel="nofollow">https://github.com/lmcai/PhyloHerb/</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37590/parallel-processing-with-perl</guid>
	<pubDate>Sat, 25 Aug 2018 11:32:40 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37590/parallel-processing-with-perl</link>
	<title><![CDATA[Parallel Processing with Perl !]]></title>
	<description><![CDATA[<p>Here is a small tutorial on how to make best use of multiple processors for bioinformatics analysis. One best way is using perl threads and forks. Knowing how these threads and forks work is very important before implementing them. Getting to know how these work would be really useful before reading this tutorial.</p><p>Many times in bioinformatics we need to deal with huge datasets which&nbsp; are more than 100GB size. The traditional way to analysis a file is using the while loop</p><p>while (FILE){</p><p>Do something;</p><p>}</p><p>This is very slow(since we are using only one processor) and if we have 500 million lines in the dataset it takes more than a day to iterate through the whole dataset. So how do we make best use of all our processors and get the work done quickly?</p><p>Here is a very simple and efficient technique with perl which i have been using. I am&nbsp; more inclined towards using perl fork than perl threads.</p><p>One of the oldest way to fork is</p><blockquote><p>my $fork = fork();<br />if($fork){&nbsp;&nbsp;&nbsp;<br />push (@childs,$fork);&nbsp;<br />}<br />elseif($fork==0){<br /><strong>your code here;</strong><br />exit(0);<br />}<br />else{die &ldquo;Couldnt fork : $!&rdquo;;}</p><p>## wait for the child process to finish<br />foreach(@childs){<br />my $tmp=waitid($_,0);<br />}</p></blockquote><p>what a fork does is it creates a child process and takes the variables and code with it to analyze it separately (detached from the parent process) and thus a separate process is created( which usually runs on a separate processor). Thats it!! One big disadvantage of forking is its very difficult to share variables among the different processes. I will show you how to do it easily but still it has its own drawbacks.</p><blockquote><p>Okie, now if you really do not want to use fork in your code, that&rsquo;s okie too..There are many useful modules which do it for you very efficiently. One really useful module is Parallel::ForkManager. You can use Parallel::ForkManager to manage the number of forks you want to generate (number of processors you want to use).</p><p><strong>Simple usage:</strong><br />use Parallel::ForkManager;<br />my $max_processors=8;<br />my $fork= new Parallel::ForkManager($max_processors);<br />foreach (@dna) {<br />$fork-&gt;start and next; # do the fork<br /><strong>you code here;</strong><br />$fork-&gt;finish; # do the exit in the child process<br />}<br />$pm-&gt;wait_all_children;</p></blockquote><p>so you will be generating 8 forks which do the same thing for your each element of array. when one child finishes, Parallel::ForkManager generates a new one and thus you will be using all your processors to analyze the data. Now, if you have generated 8 child processes and want to write the data to one file. You need to lock the file to do this, because you will have problems with the buffering. You can lock the file using flock command.</p><blockquote><p>open (my $QUAL, &ldquo;myfile.txt&rdquo;);<br />flock $QUAL, LOCK_EX or die &ldquo;cant lock file $!&rdquo;;<br />print $QUAL &ldquo;$output&rdquo;;<br />flock $QUAL, LOCK_UN or die &ldquo;$!&rdquo;;<br />close $QUAL;</p></blockquote><p>I would not suggest using flock when dealing with multiple processes because it will decrease the processing efficiency( each child process must wait for the lock to be released by the other child process). Instead, I would suggest each fork writing to a separate file and after the processing just concatenating them.</p><p><strong>Putting it all together, If you have 100GB data you can do this</strong></p><blockquote><p><strong>step 1</strong>&nbsp;: split the dataset equally according to number of processors you have. this may take a few hours(about 2-3 hrs for 100GB file)<br />You can use unix &ldquo;split&rdquo; command for this<br />for example:<br />my $number_split=int($number_of_entries_in_your_dataset/$max_processors);<br />my $split_Files=`split -l $number_split &ldquo;your_file.fasta&rdquo; &ldquo;file_name&rdquo;`;</p><p><strong>step2</strong>: open you directory comtaining you split files and start Parallel::ForkManager.<br /><strong>For example:</strong><br />opendir(DIRECTORY, $split_files_directory) or die $!; ### open the directory<br />my $fork= new Parallel::ForkManager($max_processors);<br />while (my $file = readdir(DIRECTORY)) { ### read the directory<br />if($file=~/^\./){next;}<br />print $file,&rdquo;\n&rdquo;;<br />########## Start fork ##########<br />my $pid= $super_fork-&gt;start and next;<br /><strong>Whatever you want to do with the split file ;</strong><br /><strong>analyze my piece of $file;</strong><br />######### end fork ###############<br />$super_fork-&gt;finish;<br />}<br />$super_fork-&gt;wait_all_children;</p></blockquote><p>So basically each processor will be active with its piece of data (split file) and thus you have created 8 processes at one time which run without interfering with the other process. I again will not suggest writing output from each child process to one file(for reasons above). Write output from each fork to a separate file and finally concatenate them. Thats it, you have just increased your program speed by 8 times!! Isnt it easy?</p><p><strong>Note:</strong><br />You may worry about concatenation of the output each child generates, since it does take some time(remember 100GB). I think now you can use a mysql database LOAD DATA LOCAL INFILE command to load all the files into a single table(Should take about 3hrs for 100Gb dataset) and then export the whole table into one file. This should be faster than just concatenating them using &ldquo;cat&rdquo; command.(correct me if I am wrong)</p><p>Or much simpler way is to use pipes</p><p>cat output_dir/* | my_pipe or my_pipe &lt;(file1) final_file;</p><p>Thats it guys!! Enjoy programming and please do comment. I am not a computer scientist so forgive me for any mistakes and if any please report them. Thank you.</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/38302/senior-bioinformatics-scientist-at-elucidata</guid>
  <pubDate>Tue, 27 Nov 2018 04:05:57 -0600</pubDate>
  <link></link>
  <title><![CDATA[Senior Bioinformatics Scientist at Elucidata]]></title>
  <description><![CDATA[
<p>Key Responsibilities <br />- Process and analyse metabolomic, transcriptional, genomics, proteomics <br />and any other kind of biological data. <br />- Interpret the data in the context of relevant biological literature to generate <br />actionable insights. <br />- Communicate the findings from data and literature to biologists and use the <br />biological insights to derive next steps/analyses. <br />- Communicate work through blogs, meet-ups, research papers, posters, etc. <br />- Identify, troubleshoot, and implement improvements to existing pipelines <br />and algorithms. <br />- Identify and implement new tools and pipelines to use for different types of <br />biological data. <br />- Work in a multi-disciplinary team with biologists, data scientists and data <br />analysts. <br />- Help with any other requirements (from database design to generating <br />prototypes for the product team).</p>

<p>Requirements <br />- 3-5 years of relevant bioinformatics experience such as public data mining, <br />processing, analysing and visualising omics data, etc. <br />- Ph.D., Masters or Bachelors in Bioinformatics, Biotechnology, <br />Computational Biology, or related field. <br />- Understanding of molecular biology and biochemistry. <br />- Comfort and experience with biological research and data. <br />- Proficient in a programming language used for bioinformatics such as R or <br />python. <br />- Excellent communication skills. <br />- Ability to summarise and simplify complex analyses for a non-technical <br />audience. <br />- Strong analytical skills, curiosity and a knack to solve difficult problems. <br />- Work well in multi-disciplinary teams with people of vastly different <br />backgrounds. <br />- Demonstrated success in collaboration and independent work.</p>

<p>More at https://angel.co/elucidata/jobs/460104-senior-bioinformatics-scientist</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34221/alignment-free-sequence-comparison-tools-available-for-next-generation-sequencing-data-analysis</guid>
	<pubDate>Tue, 07 Nov 2017 05:33:33 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34221/alignment-free-sequence-comparison-tools-available-for-next-generation-sequencing-data-analysis</link>
	<title><![CDATA[Alignment-free sequence comparison tools available for next-generation sequencing data analysis]]></title>
	<description><![CDATA[<div><p><span>kallisto</span></p></div><div><p>Transcript abundance quantification from RNA-seq data (uses pseudoalignment for rapid determination of read compatibility with targets)</p><p>Software (C++)</p><p><a href="https://pachterlab.github.io/kallisto/">https://pachterlab.github.io/kallisto/</a></p><p>Sailfish</p><p>Estimation of isoform abundances from reference sequences and RNA-seq data (<em>k</em>-mer based)</p><p>Software (C++)</p><p><a href="http://www.cs.cmu.edu/~ckingsf/software/sailfish/">http://www.cs.cmu.edu/~ckingsf/software/sailfish/</a></p><p>Salmon</p><p>Quantification of the expression of transcripts using RNA-seq data (uses&nbsp;<em>k</em>-mers)</p><p><a href="https://combine-lab.github.io/salmon/">https://combine-lab.github.io/salmon/</a></p><p>RNA-Skim</p><p>RNA-seq quantification at transcript-level (partitions the transcriptome into disjoint transcript clusters; uses&nbsp;<em>sig</em>-mers, a special type of&nbsp;<em>k</em>-mers)</p><p>Software (C++)</p><p><a href="http://www.csbio.unc.edu/rs/">http://www.csbio.unc.edu/rs/</a></p><p>Variant calling</p><p>ChimeRScope</p><p>Fusion transcript prediction using gene&nbsp;<em>k</em>-mers profiles of the RNA-seq paired-end reads</p><p>Software (Java)</p><p><a href="https://github.com/ChimeRScope/ChimeRScope/wiki">https://github.com/ChimeRScope/ChimeRScope/wiki</a></p><p>FastGT</p><p>Genotyping of known SNV/SNP variants directly from raw NGS sequence reads by counting unique&nbsp;<em>k</em>-mers</p><p>Software (C)</p><p><a href="https://github.com/bioinfo-ut/GenomeTester4/">https://github.com/bioinfo-ut/GenomeTester4/</a></p><p>Phy-Mer</p><p>Reference-independent mitochondrial haplogroup classifier from NGS data (<em>k</em>-mer based)</p><p>Software (Python)</p><p><a href="https://github.com/danielnavarrogomez/phy-mer">https://github.com/danielnavarrogomez/phy-mer</a></p><p>LAVA</p><p>Genotyping of known SNPs (dbSNP and Affymetrix's Genome-Wide Human SNP Array) from raw NGS reads (<em>k</em>-mer based)</p><p>Software (C)</p><p><a href="http://lava.csail.mit.edu/">http://lava.csail.mit.edu/</a></p><p>MICADo</p><p>Detection of mutations in targeted third-generation NGS data (can distinguish patients&rsquo; specific mutations; algorithm uses&nbsp;<em>k</em>-mers and is based on colored de Bruijn graphs)</p><p>Software (Python)</p><p><a href="http://github.com/cbib/MICADo">http://github.com/cbib/MICADo</a></p><p>General mapper</p><p>Minimap</p><p>Lightweight and fast read mapper and read overlap detector (uses the concept of &ldquo;minimazers&rdquo;, a special type of&nbsp;<em>k</em>-mers)</p><p>Software (C)</p><p><a href="https://github.com/lh3/minimap">https://github.com/lh3/minimap</a></p><p>Assembly</p><p>De novo genome assembly</p><p>MHAP</p><p>Produces highly continuous assembly (fully resolved chromosome arms) from third-generation long and noisy reads (10 kbp) using a dimensionality reduction technique MinHash</p><p>Software (Java)</p><p><a href="https://github.com/marbl/MHAP">https://github.com/marbl/MHAP</a></p><p>Miniasm</p><p>Assembler of long noisy reads (SMRT, ONT) using the Overlap-Layout Consensus (OLC) approach without the necessity of an error correction stage (uses minimap)</p><p>Software (C)</p><p><a href="https://github.com/lh3/miniasm">https://github.com/lh3/miniasm</a></p><p>LINKS</p><p>Scaffolding genome assembly with error-containing long sequence (e.g., ONT or PacBio reads, draft genomes)</p><p>Software (Perl)</p><p><a href="https://github.com/warrenlr/LINKS/">https://github.com/warrenlr/LINKS/</a></p><p>Read clustering</p><p>afcluster</p><p>Clustering of reads from different genes and different species based on&nbsp;<em>k</em>-mer counts</p><p>Software (C++)</p><p><a href="https://github.com/luscinius/afcluster">https://github.com/luscinius/afcluster</a></p><p>QCluster</p><p>Clustering of reads with alignment-free measures (<em>k</em>-mer based) and quality values</p><p>Software (C++)</p><p><a href="http://www.dei.unipd.it/~ciompin/main/qcluster.html">http://www.dei.unipd.it/~ciompin/main/qcluster.html</a></p><p>Reads error correction</p><p>Lighter</p><p>Correction of sequencing errors in raw, whole genome sequencing reads (<em>k</em>-mer based)</p><p>Software (C++)</p><p><a href="https://github.com/mourisl/Lighter">https://github.com/mourisl/Lighter</a></p><p>QuorUM</p><p>Error corrector for Illumina reads using k-mers</p><p>Software (C++)</p><p><a href="https://github.com/gmarcais/Quorum">https://github.com/gmarcais/Quorum</a></p><p>Trowel</p><p>Software (C++)</p><p><a href="https://sourceforge.net/projects/trowel-ec/">https://sourceforge.net/projects/trowel-ec/</a></p><p>Metagenomics</p><p>Assembly-free phylogenomics</p><p>AAF</p><p>Phylogeny reconstruction directly from unassembled raw sequence data from whole genome sequencing projects; provides bootstrap support to assess uncertainty in the tree topology (<em>k</em>-mer based)</p><p>Software (Python)</p><p><a href="https://github.com/fanhuan/AAF">https://github.com/fanhuan/AAF</a></p><p>kSNP v3</p><p>Reference-free SNP identification and estimation of phylogenetic trees using SNPs (based on&nbsp;<em>k</em>-mer analysis)</p><p>Software (C)</p><p><a href="https://sourceforge.net/projects/ksnp/files/">https://sourceforge.net/projects/ksnp/files/</a></p><p>NGS-MC</p><p>Phylogeny of species based on NGS reads using alignment-free sequence dissimilarity measures d2* and d2&nbsp;S&nbsp;under different Markov chain models (using&nbsp;<em>k</em>-words)</p><p>R package</p><p><a href="http://www-rcf.usc.edu/~fsun/Programs/NGS-MC/NGS-MC.html">http://www-rcf.usc.edu/~fsun/Programs/NGS-MC/NGS-MC.html</a></p><p>Species identification/taxonomic profiling</p><p>CLARK</p><p>Taxonomic classification of metagenomic reads to known bacterial genomes using&nbsp;<em>k</em>-mer search and LCA assignment</p><p>Software (C++)</p><p><a href="http://clark.cs.ucr.edu/">http://clark.cs.ucr.edu/</a></p><p>FOCUS</p><p>Reports organisms present in metagenomic samples and profiles their abundances (uses composition-based approach and non-negative least squares for prediction)</p><p>Web service Software (Python)</p><p><a href="http://edwards.sdsu.edu/FOCUS/">http://edwards.sdsu.edu/FOCUS/</a></p><p>GSM</p><p>Estimation of abundances of microbial genomes in metagenomic samples (<em>k</em>-mer based)</p><p>Software (Go)</p><p><a href="https://github.com/pdtrang/GSM">https://github.com/pdtrang/GSM</a></p><p>Mash</p><p>Species identification using assembled or unassembled Illumina, PacBio, and ONT data (based on MinHash dimensionality-reduction technique)</p><p>Software (C++)</p><p><a href="https://github.com/marbl/mash">https://github.com/marbl/mash</a></p><p>Kraken</p><p>Taxonomic assignment in metagenome analysis by exact&nbsp;<em>k</em>-mer search; LCA assignment of short reads based on a comprehensive sequence database</p><p>Software (C++)</p><p><a href="https://ccb.jhu.edu/software/kraken/">https://ccb.jhu.edu/software/kraken/</a></p><p>LMAT</p><p>Assignment of taxonomic labels to reads by&nbsp;<em>k</em>-mers searches in precomputed database</p><p>Software (C++/Python)</p><p><a href="https://sourceforge.net/projects/lmat/">https://sourceforge.net/projects/lmat/</a></p><p>stringMLST</p><p><em>k</em>-mer-based tool for MLST directly from the genome sequencing reads</p><p>Software (Python)</p><p><a href="http://jordan.biology.gatech.edu/page/software/stringMLST">http://jordan.biology.gatech.edu/page/software/stringMLST</a></p><p>Taxonomer</p><p><em>k</em>-mer-based ultrafast metagenomics tool for assigning taxonomy to sequencing reads from clinical and environmental samples</p><p>Web service</p><p><a href="http://taxonomer.iobio.io/">http://taxonomer.iobio.io/</a></p><p>Other</p><p>d2-tools</p><p>Word-based (<em>k</em>-tuple) comparison (pairwise dissimilarity matrix using d2S measure) of metatranscriptomic samples from NGS reads</p><p>Software (Python/R)</p><p><a href="https://code.google.com/p/d2-tools/">https://code.google.com/p/d2-tools/</a></p><p>VirHostMatcher</p><p>Prediction of hosts from metagenomic viral sequences based on ONF using various distance measures (e.g., d2)</p><p>Software (C++)</p><p><a href="https://github.com/jessieren/VirHostMatcher">https://github.com/jessieren/VirHostMatcher</a></p><p>MetaFast</p><p>Statistics calculation of metagenome sequences and the distances between them based on assembly using de Bruijn graphs and Bray&ndash;Curtis dissimilarity measure</p><p>Software (Java)</p><p><a href="https://github.com/ctlab/metafast">https://github.com/ctlab/metafast</a></p></div>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39025/binc-exam-merged-with-dbt-bet-jrf-exam</guid>
	<pubDate>Thu, 21 Feb 2019 09:37:36 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39025/binc-exam-merged-with-dbt-bet-jrf-exam</link>
	<title><![CDATA[BINC Exam merged with DBT- BET JRF Exam]]></title>
	<description><![CDATA[<p>Another breaking news received has been received from the Department of biotechnology &ndash; DBT. As per a notification released by DBT, Bioinformatics National Certification (BINC) Exam conducted once per year by DBT has been now merged with DBT- BET JRF Exam.</p><p>Also, Bioinformatics Industrial Training Program (BIITP) is merged with the HRD Biotechnology Industrial Training Programme (BITP).</p><p>While this comes as a surprise for a lot of participants. We believe this is a good attempt to unify and create a national benchmark for talent. And we appreciate this endeavor from Department of biotechnology.</p><p>However, such last-minute announcements can create confusion. Thus candidates are advised to go through the complete notification DBT-BET JRF 2019 via the link below.If you have any kind of doubts, you must contact DBT JRF or Biotecnika for any kind of help &amp; assistance.</p><p><br />Attention:-Bioinformatics Programs (BINC and BIITP)</p><p>1. Bioinformatics National Certification (BINC) has been merged with DBT-Junior<br />Research Fellow (BET Exam)</p><p>2. Bioinformatics Industrial Training Program (BIITP) is merged with HRDBiotechnology Industrial Training Programme (BITP).</p><p>Students of Bioinformatics, who are interested to apply for Fellowship or Industrial<br />Training may keep track of the advertisement of DBT-JRF (BET Exam) and BITP<br />of DBT.</p><p>&nbsp;More at&nbsp;http://www.bcil.nic.in/files/Attention_Bioinformatics_Programs_(BINC_and_BIITP).pdf</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>