<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30205?offset=560</link>
	<atom:link href="https://bioinformaticsonline.com/related/30205?offset=560" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</guid>
	<pubDate>Sun, 20 Dec 2020 11:43:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</link>
	<title><![CDATA[BioJupies: Automatically Generates RNA-seq Data Analysis Notebooks]]></title>
	<description><![CDATA[<p>With BioJupies you can produce in seconds a customized, reusable, and interactive report from your own raw or processed RNA-seq data through a simple user interface</p>
<p>BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.</p><p>Address of the bookmark: <a href="https://amp.pharm.mssm.edu/biojupies/" rel="nofollow">https://amp.pharm.mssm.edu/biojupies/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44470/phyloherb-phylogenomic-analysis-pipeline-for-herbarium-specimens</guid>
	<pubDate>Wed, 21 Feb 2024 06:15:13 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44470/phyloherb-phylogenomic-analysis-pipeline-for-herbarium-specimens</link>
	<title><![CDATA[PhyloHerb: Phylogenomic Analysis Pipeline for Herbarium Specimens]]></title>
	<description><![CDATA[<p><span>What is PhyloHerb</span><span>: PhyloHerb is a wrapper program to process&nbsp;</span><span>genome skimming</span><span>&nbsp;data collected from plant materials. The outcomes include the plastid genome (plastome) assemblies, mitochondrial genome assemblies, nuclear ribosomal DNAs (NTS+ETS+18S+ITS1+5.8S+ITS2+28S), alignments of gene and intergenic regions, and a species tree. It is designed to be a high throughput program dealing with lower quality data. Examples include&nbsp;</span><span>low-coverage (5x cpDNA) plastome phylogeny, recycling plastid genes from target enrichment data, retrieving low-copy nuclear genes from medium coverage (5x nucDNA) genome skimming</span><span>.</span></p><p>Address of the bookmark: <a href="https://github.com/lmcai/PhyloHerb/" rel="nofollow">https://github.com/lmcai/PhyloHerb/</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34221/alignment-free-sequence-comparison-tools-available-for-next-generation-sequencing-data-analysis</guid>
	<pubDate>Tue, 07 Nov 2017 05:33:33 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34221/alignment-free-sequence-comparison-tools-available-for-next-generation-sequencing-data-analysis</link>
	<title><![CDATA[Alignment-free sequence comparison tools available for next-generation sequencing data analysis]]></title>
	<description><![CDATA[<div><p><span>kallisto</span></p></div><div><p>Transcript abundance quantification from RNA-seq data (uses pseudoalignment for rapid determination of read compatibility with targets)</p><p>Software (C++)</p><p><a href="https://pachterlab.github.io/kallisto/">https://pachterlab.github.io/kallisto/</a></p><p>Sailfish</p><p>Estimation of isoform abundances from reference sequences and RNA-seq data (<em>k</em>-mer based)</p><p>Software (C++)</p><p><a href="http://www.cs.cmu.edu/~ckingsf/software/sailfish/">http://www.cs.cmu.edu/~ckingsf/software/sailfish/</a></p><p>Salmon</p><p>Quantification of the expression of transcripts using RNA-seq data (uses&nbsp;<em>k</em>-mers)</p><p><a href="https://combine-lab.github.io/salmon/">https://combine-lab.github.io/salmon/</a></p><p>RNA-Skim</p><p>RNA-seq quantification at transcript-level (partitions the transcriptome into disjoint transcript clusters; uses&nbsp;<em>sig</em>-mers, a special type of&nbsp;<em>k</em>-mers)</p><p>Software (C++)</p><p><a href="http://www.csbio.unc.edu/rs/">http://www.csbio.unc.edu/rs/</a></p><p>Variant calling</p><p>ChimeRScope</p><p>Fusion transcript prediction using gene&nbsp;<em>k</em>-mers profiles of the RNA-seq paired-end reads</p><p>Software (Java)</p><p><a href="https://github.com/ChimeRScope/ChimeRScope/wiki">https://github.com/ChimeRScope/ChimeRScope/wiki</a></p><p>FastGT</p><p>Genotyping of known SNV/SNP variants directly from raw NGS sequence reads by counting unique&nbsp;<em>k</em>-mers</p><p>Software (C)</p><p><a href="https://github.com/bioinfo-ut/GenomeTester4/">https://github.com/bioinfo-ut/GenomeTester4/</a></p><p>Phy-Mer</p><p>Reference-independent mitochondrial haplogroup classifier from NGS data (<em>k</em>-mer based)</p><p>Software (Python)</p><p><a href="https://github.com/danielnavarrogomez/phy-mer">https://github.com/danielnavarrogomez/phy-mer</a></p><p>LAVA</p><p>Genotyping of known SNPs (dbSNP and Affymetrix's Genome-Wide Human SNP Array) from raw NGS reads (<em>k</em>-mer based)</p><p>Software (C)</p><p><a href="http://lava.csail.mit.edu/">http://lava.csail.mit.edu/</a></p><p>MICADo</p><p>Detection of mutations in targeted third-generation NGS data (can distinguish patients&rsquo; specific mutations; algorithm uses&nbsp;<em>k</em>-mers and is based on colored de Bruijn graphs)</p><p>Software (Python)</p><p><a href="http://github.com/cbib/MICADo">http://github.com/cbib/MICADo</a></p><p>General mapper</p><p>Minimap</p><p>Lightweight and fast read mapper and read overlap detector (uses the concept of &ldquo;minimazers&rdquo;, a special type of&nbsp;<em>k</em>-mers)</p><p>Software (C)</p><p><a href="https://github.com/lh3/minimap">https://github.com/lh3/minimap</a></p><p>Assembly</p><p>De novo genome assembly</p><p>MHAP</p><p>Produces highly continuous assembly (fully resolved chromosome arms) from third-generation long and noisy reads (10 kbp) using a dimensionality reduction technique MinHash</p><p>Software (Java)</p><p><a href="https://github.com/marbl/MHAP">https://github.com/marbl/MHAP</a></p><p>Miniasm</p><p>Assembler of long noisy reads (SMRT, ONT) using the Overlap-Layout Consensus (OLC) approach without the necessity of an error correction stage (uses minimap)</p><p>Software (C)</p><p><a href="https://github.com/lh3/miniasm">https://github.com/lh3/miniasm</a></p><p>LINKS</p><p>Scaffolding genome assembly with error-containing long sequence (e.g., ONT or PacBio reads, draft genomes)</p><p>Software (Perl)</p><p><a href="https://github.com/warrenlr/LINKS/">https://github.com/warrenlr/LINKS/</a></p><p>Read clustering</p><p>afcluster</p><p>Clustering of reads from different genes and different species based on&nbsp;<em>k</em>-mer counts</p><p>Software (C++)</p><p><a href="https://github.com/luscinius/afcluster">https://github.com/luscinius/afcluster</a></p><p>QCluster</p><p>Clustering of reads with alignment-free measures (<em>k</em>-mer based) and quality values</p><p>Software (C++)</p><p><a href="http://www.dei.unipd.it/~ciompin/main/qcluster.html">http://www.dei.unipd.it/~ciompin/main/qcluster.html</a></p><p>Reads error correction</p><p>Lighter</p><p>Correction of sequencing errors in raw, whole genome sequencing reads (<em>k</em>-mer based)</p><p>Software (C++)</p><p><a href="https://github.com/mourisl/Lighter">https://github.com/mourisl/Lighter</a></p><p>QuorUM</p><p>Error corrector for Illumina reads using k-mers</p><p>Software (C++)</p><p><a href="https://github.com/gmarcais/Quorum">https://github.com/gmarcais/Quorum</a></p><p>Trowel</p><p>Software (C++)</p><p><a href="https://sourceforge.net/projects/trowel-ec/">https://sourceforge.net/projects/trowel-ec/</a></p><p>Metagenomics</p><p>Assembly-free phylogenomics</p><p>AAF</p><p>Phylogeny reconstruction directly from unassembled raw sequence data from whole genome sequencing projects; provides bootstrap support to assess uncertainty in the tree topology (<em>k</em>-mer based)</p><p>Software (Python)</p><p><a href="https://github.com/fanhuan/AAF">https://github.com/fanhuan/AAF</a></p><p>kSNP v3</p><p>Reference-free SNP identification and estimation of phylogenetic trees using SNPs (based on&nbsp;<em>k</em>-mer analysis)</p><p>Software (C)</p><p><a href="https://sourceforge.net/projects/ksnp/files/">https://sourceforge.net/projects/ksnp/files/</a></p><p>NGS-MC</p><p>Phylogeny of species based on NGS reads using alignment-free sequence dissimilarity measures d2* and d2&nbsp;S&nbsp;under different Markov chain models (using&nbsp;<em>k</em>-words)</p><p>R package</p><p><a href="http://www-rcf.usc.edu/~fsun/Programs/NGS-MC/NGS-MC.html">http://www-rcf.usc.edu/~fsun/Programs/NGS-MC/NGS-MC.html</a></p><p>Species identification/taxonomic profiling</p><p>CLARK</p><p>Taxonomic classification of metagenomic reads to known bacterial genomes using&nbsp;<em>k</em>-mer search and LCA assignment</p><p>Software (C++)</p><p><a href="http://clark.cs.ucr.edu/">http://clark.cs.ucr.edu/</a></p><p>FOCUS</p><p>Reports organisms present in metagenomic samples and profiles their abundances (uses composition-based approach and non-negative least squares for prediction)</p><p>Web service Software (Python)</p><p><a href="http://edwards.sdsu.edu/FOCUS/">http://edwards.sdsu.edu/FOCUS/</a></p><p>GSM</p><p>Estimation of abundances of microbial genomes in metagenomic samples (<em>k</em>-mer based)</p><p>Software (Go)</p><p><a href="https://github.com/pdtrang/GSM">https://github.com/pdtrang/GSM</a></p><p>Mash</p><p>Species identification using assembled or unassembled Illumina, PacBio, and ONT data (based on MinHash dimensionality-reduction technique)</p><p>Software (C++)</p><p><a href="https://github.com/marbl/mash">https://github.com/marbl/mash</a></p><p>Kraken</p><p>Taxonomic assignment in metagenome analysis by exact&nbsp;<em>k</em>-mer search; LCA assignment of short reads based on a comprehensive sequence database</p><p>Software (C++)</p><p><a href="https://ccb.jhu.edu/software/kraken/">https://ccb.jhu.edu/software/kraken/</a></p><p>LMAT</p><p>Assignment of taxonomic labels to reads by&nbsp;<em>k</em>-mers searches in precomputed database</p><p>Software (C++/Python)</p><p><a href="https://sourceforge.net/projects/lmat/">https://sourceforge.net/projects/lmat/</a></p><p>stringMLST</p><p><em>k</em>-mer-based tool for MLST directly from the genome sequencing reads</p><p>Software (Python)</p><p><a href="http://jordan.biology.gatech.edu/page/software/stringMLST">http://jordan.biology.gatech.edu/page/software/stringMLST</a></p><p>Taxonomer</p><p><em>k</em>-mer-based ultrafast metagenomics tool for assigning taxonomy to sequencing reads from clinical and environmental samples</p><p>Web service</p><p><a href="http://taxonomer.iobio.io/">http://taxonomer.iobio.io/</a></p><p>Other</p><p>d2-tools</p><p>Word-based (<em>k</em>-tuple) comparison (pairwise dissimilarity matrix using d2S measure) of metatranscriptomic samples from NGS reads</p><p>Software (Python/R)</p><p><a href="https://code.google.com/p/d2-tools/">https://code.google.com/p/d2-tools/</a></p><p>VirHostMatcher</p><p>Prediction of hosts from metagenomic viral sequences based on ONF using various distance measures (e.g., d2)</p><p>Software (C++)</p><p><a href="https://github.com/jessieren/VirHostMatcher">https://github.com/jessieren/VirHostMatcher</a></p><p>MetaFast</p><p>Statistics calculation of metagenome sequences and the distances between them based on assembly using de Bruijn graphs and Bray&ndash;Curtis dissimilarity measure</p><p>Software (Java)</p><p><a href="https://github.com/ctlab/metafast">https://github.com/ctlab/metafast</a></p></div>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35920/mesquite-a-modular-system-for-evolutionary-analysis</guid>
	<pubDate>Tue, 13 Mar 2018 06:54:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35920/mesquite-a-modular-system-for-evolutionary-analysis</link>
	<title><![CDATA[Mesquite: A modular system for evolutionary analysis]]></title>
	<description><![CDATA[<p><span>Mesquite is modular, extendible software for evolutionary biology, designed to help biologists organize and analyze comparative data about organisms. Its emphasis is on phylogenetic analysis, but some of its modules concern population genetics, while others do non-phylogenetic multivariate analysis. Because it is modular, the analyses available depend on the modules installed.</span></p>
<p><span>https://github.com/MesquiteProject/MesquiteCore</span></p><p>Address of the bookmark: <a href="http://mesquiteproject.org/" rel="nofollow">http://mesquiteproject.org/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/29644/junior-research-fellow-at-rajiv-gandhi-centre-for-biotechnology-thiruvananthapuram</guid>
  <pubDate>Mon, 07 Nov 2016 10:27:06 -0600</pubDate>
  <link></link>
  <title><![CDATA[Junior Research Fellow at Rajiv Gandhi Centre for Biotechnology, Thiruvananthapuram]]></title>
  <description><![CDATA[
<p>Adv. # 22/ 2016<br />Applications are invited from suitable candidates for one position of Junior Research Fellow in a DST funded bioinformatics research project entitled "Major gene influxes in microbial genome evolution" in the Laboratory of Dr. Shijulal Nelson-Sathi at Rajiv Gandhi Centre for Biotechnology, Thiruvananthapuram.</p>

<p>ESSENTIAL QUALIFICATIONS:<br />We are looking for a motivated candidate with keen interest in bioinformatics and microbial genome evolution. The candidate must have a Master’s Degree in Bioinformatics, Computational Biology, Computer Science, Microbiology, Biology or a related field with good academic record.</p>

<p>DESIRABLE QUALIFICATIONS<br />Hands on research experience on handling next generation sequencing data and phylogenetic reconstruction methods. Excellent programming skills (Perl/Python/Java/Php) and experience in working on Unix/Linux platform is preferred. Furthermore; good knowledge is required in statistics (R/Matlab) and the application of bioinformatics analysis tools.</p>

<p>AGE:<br />Below 28 years as on 15th November, 2016.</p>

<p>EMOLUMENTS:<br />Rs. 25,000 + 20% HRA for NET/GATE qualified and Post Graduate in Professional Degree course qualified candidates and <br />Rs. 12,000/- + 20% HRA for others.</p>

<p>DURATION:<br />Initial appointment will be given for one year and further extension will be based on the performance till termination of the project.<br />Only those fulfilling the above criteria need apply and will be called for interview. In the event of more than 10 candidates being short-listed by screening the applications, a written test will be conducted before the selection interview and only those who are successful in the written test will be interviewed. No TA/ DA will be given for appearing in the interview.</p>

<p>Suitably qualified candidates may send applications in the prescribed format (Download here) with a photograph, a copy of full resume indicating the percentage of Marks obtained and attested photocopies of credentials &amp; experience to reach the undersigned on or before 15th November, 2016. Envelopes must be superscripted with abbreviated title of the project, advertisement number and job title. Selection to the position will not entitle the candidate to any future positions at RGCB (permanent or otherwise). As with all project positions at RGCB, the position will be co terminus with end of the project.</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/29883/ra-bioinformatics-at-school-of-computational-integrative-sciences-jnu-india</guid>
  <pubDate>Fri, 18 Nov 2016 03:57:56 -0600</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at School of Computational &amp; Integrative Sciences, JNU, India]]></title>
  <description><![CDATA[
<p>School of Computational &amp; Integrative Sciences<br />Jawaharlal Nehru University<br />New Delhi – 110067</p>

<p>Date: Nov 11th. 2016                                                            Last Date:  Nov 25th. 2016</p>

<p>PROJECT ID: 632</p>

<p>The following posts are urgently required to be filled for the Department of Biotechnology, Government of India funded project entitled "Computational Core for Plant Metabolomics" administrated by Prof Indira Ghosh,  School of Computational and Integrative Sciences, Jawaharlal Nehru University, New Delhi-110 067</p>

<p>NB:For all Bioinformatics posts, preference will be given to candidates with a good knowledge of Python and/or R. Knowledge of JAVA will also get a special consideration.</p>

<p>RA / Research Associate (Metabolic engineering/Computational Biologist)</p>

<p>Salary: Rs. 36000/- + HRA<br />Vacancy: 1<br />Essential Qualifications: PhD in  Bioinformatics /Mathematics/Computer Science with experience in analyzing high throughput omics-based data/ system Biology/ Analysis of Network Biology. Published paper in the field is a must to prove the experience.<br />Desired Skills: Prior experience in handling and guiding bioinformatics, metabolomics data, planning of new research area in metabolic driven network , managing the project portal, preparing and filing reports etc. Will be expected to communicate with user groups and coordinate with LIMS group in Hyderabad and the Cheminformatics group in Delhi.</p>

<p>RA / Research Associate (Chemo-informatics/Computational Biologist)</p>

<p>Salary: Rs. 36000/- + HRA<br />Vacancy: 1<br />Essential Qualifications: PhD in Bioinformatics/ computational biology/ Biophysics/Computer Science. Computational and Chemical structure related experience is a necessary qualification proven by paper published and program developed. <br />Desired Skills:  Research experience in Chemical scaffold mapping, in silico Spectral analysis, Biological Database Designing &amp; Integration is required. Individual is responsible to develop methods related to metabolite identification, Testing and refining and integrate LIMS with IIIT Hyderabad and will be expected to communicate with user groups.</p>

<p>Project SRF (Bioinformatics/Programming)</p>

<p>Salary: As per DBT rules<br />Vacancy: 1<br />Essential Qualifications: Masters/B Tech in Basic Sciences with at least 2yrs of research experience in Bioinformatics/Computational Biology related to Database /portal building &amp; maintenance ,high throughput data handling and analysis etc. For M.Sc/B.Tec, Published paper  in peer-reviewed Journal and for M.Tech, thesis submission in computational biology is a must.</p>

<p>More at http://www.jnu.ac.in/Career/currentjobs.htm</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41559/dahak-benchmarking-and-containerization-of-tools-for-analysis-of-complex-non-clinical-metagenomes</guid>
	<pubDate>Thu, 09 Apr 2020 04:56:09 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41559/dahak-benchmarking-and-containerization-of-tools-for-analysis-of-complex-non-clinical-metagenomes</link>
	<title><![CDATA[Dahak: benchmarking and containerization of tools for analysis of complex non-clinical metagenomes.]]></title>
	<description><![CDATA[<p><span>Dahak is a software suite that integrates state-of-the-art open source tools for metagenomic analyses. Tools in the dahak software suite will perform various steps in metagenomic analysis workflows including data pre-processing, metagenome assembly, taxonomic and functional classification, genome binning, and gene assignment. We aim to deliver the analytical framework as a robust and reliable containerized workflow system, which will be free from dependency, installation, and execution problems typically associated with other open-source bioinformatics solutions. This will maximize the transparency, data provenance (i.e., the process of tracing the origins of data and its movement through the workflow), and reproducibility.</span></p>
<p><span>More at&nbsp;<a href="https://dahak-metagenomics.github.io/dahak/">https://dahak-metagenomics.github.io/dahak/</a></span></p><p>Address of the bookmark: <a href="https://github.com/dahak-metagenomics/dahak" rel="nofollow">https://github.com/dahak-metagenomics/dahak</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/29998/csir-nehru-science-postdoctoral-research-fellowship</guid>
  <pubDate>Tue, 29 Nov 2016 12:34:59 -0600</pubDate>
  <link></link>
  <title><![CDATA[CSIR Nehru Science Postdoctoral Research Fellowship]]></title>
  <description><![CDATA[
<p>CSIR Nehru Science Postdoctoral Research Fellowship</p>

<p>About Fellowship: <br />CSIR Nehru Science Postdoctoral Research Fellowship Scheme is an Research Fellowship awarded/given by HRD Ministry, Govt. of India every year to more than 100 fellows.</p>

<p>It was started to identify promising and young researchers with novel ideas and provide them research opportunities in the areas of basic science, engineering, medicine &amp; agriculture.</p>

<p>The fellowship aims at facilitating their transition from mentored to independent research career.</p>

<p>In addition, check these ICTS Research Fellowships:<br />1.) Max-Planck Partner Group Fellowships 2017-18<br />2.) ICTS-Simons Postdoctoral Fellowships 2017<br />3.) ICTS Post Doctoral Fellowships 2017<br />4.) Airbus Prize Postdoctoral Fellowship 2017-18</p>

<p>Eligibility: To be eligible for this fellowship, you:<br />1.) PhD degree (within 3 years of award of PhD degree), OR<br />2.) Those who have submitted PhD theses.<br />3.) Applicants should have research publications in good impact factor SCI journals.<br />4.) Indian nationals, Persons of Indian Origin (PIO) &amp; Overseas Citizen of India (OCI), a can also apply.<br />5.) Maximum Age Limit: 32 years.</p>

<p>Duration: <br />– 2 Years.<br />– extendable for a maximum of 1 more year based on performance.</p>

<p>Remuneration: <br />– Rs. 50,000/- per month plus House Rent Allowance (HRA)<br />– A contingency grant of Rs. 3.0 lakh per annum.<br />– 25% of the contingency grant can be used for domestic and international travel.</p>

<p>Mode of Selection: You can apply throughout the year, but selection will be made twice a year, in June and December.</p>

<p>How to Apply: <br />– Read the instructions, given at Annexure-I in this PDF file.<br />– And, application form is given as, Annexure-II.<br />– Fill the form &amp; send it to the given address in the PDF file.</p>

<p>Deadline: Rolling Deadline (Applications accepted throughout the year)</p>

<p>Also See: Research Internship/ Fellowship in India:<br />1.) IIT Bombay Research Internship Awards Programme 2016-17<br />2.) IIT Delhi Internship Program 2016-17<br />3.) DAAD WISE – International Internship in Germany<br />4.) Summer Research Fellowship Programme| JNCASR Bangalore<br />5.) Indian Academy of Sciences Summer Internships 2017<br />6.) Winter Internship – IIT Bombay NPDE-TCA<br />7.) Viterbi – India Program 2017 | Research Internship in US<br />8.) Internship – Centre for Stem Cell Research, Vellore</p>

<p>Accommodation &amp; other benefits: <br />– Accommodation may be provided by CSIR, if available.<br />– Medical benefits as per CSIR norms.</p>

<p>For more details: <br />– Check this PDF Notification of Fellowship.<br />– List of CSIR Labs &amp; their work/activities can be seen at www.csir.res.in.</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42359/dnasp-dna-sequence-polymorphism-is-a-software-package-for-the-analysis-of-dna-polymorphisms</guid>
	<pubDate>Wed, 25 Nov 2020 19:51:38 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42359/dnasp-dna-sequence-polymorphism-is-a-software-package-for-the-analysis-of-dna-polymorphisms</link>
	<title><![CDATA[DnaSP: DNA Sequence Polymorphism, is a software package for the analysis of DNA polymorphisms]]></title>
	<description><![CDATA[<p><span>DnaSP, DNA Sequence Polymorphism, is a software package for the analysis of DNA polymorphisms using data from a single locus (a multiple sequence aligned -MSA data), or from several loci (a Multiple-MSA data, such as formats generated by some assembler RAD-seq software). DnaSP can estimate several measures of DNA sequence variation within and between populations in noncoding, synonymous or nonsynonymous sites, or in various sorts of codon positions), as well as linkage disequilibrium, recombination, gene flow and gene conversion parameters.</span></p><p>Address of the bookmark: <a href="http://www.ub.edu/dnasp/" rel="nofollow">http://www.ub.edu/dnasp/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>