<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30205?offset=630</link>
	<atom:link href="https://bioinformaticsonline.com/related/30205?offset=630" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/4093/ibm-research-computational-biology-center</guid>
	<pubDate>Thu, 29 Aug 2013 08:43:59 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/4093/ibm-research-computational-biology-center</link>
	<title><![CDATA[IBM Research Computational Biology Center]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/lr2bB_2g_Uc" frameborder="0" allowfullscreen></iframe>The IBM Computational Biology Center embraces activities at Yorktown Heights, with strong affiliations with activities at Almaden and other IBM Research Centers. Computational Biology (CompBio) including bioinformatics is the study of how computer systems can manage, analyze, and simulate the complex structures and processes inherent in living systems. CompBio Research at IBM spans pattern recognition in sequences, structures and processes, the studying of systems ranging from single protein molecules through to complex molecular interactions, and the data analysis, interpretation and reverse-engineering of complex disease-lifestyle-genomic interactions for fuller biological understanding. "CompBio" has a flavor of its own independant of its parents, biology and computer science. Nonetheless, CompBio is inherently a multi- disciplinary field with important applications in biology, chemical physics, materials science, agriculture, chemistry and ultimately nanotechnology.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34620/mash-fast-genome-and-metagenome-distance-estimation-using-minhash</guid>
	<pubDate>Tue, 12 Dec 2017 17:30:12 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34620/mash-fast-genome-and-metagenome-distance-estimation-using-minhash</link>
	<title><![CDATA[Mash: fast genome and metagenome distance estimation using MinHash]]></title>
	<description><![CDATA[<p>Mash is normally distributed as a dependency-free binary for Linux or OSX (see&nbsp;<a href="https://github.com/marbl/Mash/releases">https://github.com/marbl/Mash/releases</a>). This source distribution is intended for other operating systems or for development. Mash requires c++11 to build, which is available in and GCC &gt;= 4.8 and OSX &gt;= 10.7.</p>
<p>See&nbsp;<a href="http://mash.readthedocs.org/">http://mash.readthedocs.org</a>&nbsp;for more information.</p><p>Address of the bookmark: <a href="https://github.com/marbl/Mash/releases" rel="nofollow">https://github.com/marbl/Mash/releases</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/4271/may-17-2013-differential-network-analysis</guid>
	<pubDate>Wed, 04 Sep 2013 16:22:28 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/4271/may-17-2013-differential-network-analysis</link>
	<title><![CDATA[May 17, 2013 - Differential Network Analysis]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/BvD6SkZRw9w" frameborder="0" allowfullscreen></iframe>Steve Horvath presents Differential Network Analysis at the UCLA Human Genetics/Biostatistics Network Course]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</guid>
	<pubDate>Sat, 03 Feb 2018 04:59:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</link>
	<title><![CDATA[MUMmer4: A fast and versatile genome alignment system]]></title>
	<description><![CDATA[<p><span>MUMmer4, a substantially improved version of MUMmer that addresses genome size constraints by changing the 32-bit suffix tree data structure at the core of MUMmer to a 48-bit suffix array, and that offers improved speed through parallel processing of input query sequences. With a theoretical limit on the input size of 141Tbp, MUMmer4 can now work with input sequences of any biologically realistic length. We show that as a result of these enhancements, the&nbsp;</span><span>nucmer</span><span>&nbsp;program in MUMmer4 is easily able to handle alignments of large genomes;&nbsp;</span></p><p>Address of the bookmark: <a href="https://mummer4.github.io/" rel="nofollow">https://mummer4.github.io/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4353/project-fellow-alagappa-university</guid>
  <pubDate>Sat, 07 Sep 2013 14:24:13 -0500</pubDate>
  <link></link>
  <title><![CDATA[Project Fellow @ Alagappa University]]></title>
  <description><![CDATA[
<p>Advertisement for the post of project Fellow in UGC project</p>

<p>Project Fellow – One Post</p>

<p>Duration: Three Years</p>

<p>Fellowship : Rs.14, 000/- per month + HRA</p>

<p>Walk-in-interview: 16th Sept, 2013 at 10.00 am</p>

<p>Venue : Department of Bioinformatics, Alagappa University</p>

<p>Eligible candidates can attend walk in interview for the post of Project Fellow in UGC supported project entitled “Shape and chemical feature based 3D- Pharmacophore Model generation, Virtual Screening and MESP studies to identify Potential Leads for Antifungal Azoles”</p>

<p>Interested candidates may apply to Dr. Sanjeev Kumar Singh, Principal Investigator, Department of Bioinformatics, Karaikudi with their Curriculum Vitae along with the copies of the certificates in proof of their educational qualification and experience at skysanjeev@gmail.com</p>

<p>Qualification:</p>

<p>PG Degree in Bioinformatics / Chemistry/ Molecular Biology/ Biotechnology / Biophysics / Biochemistry / Life Sciences/ Pharmacy with minimum of 55% marks in the PG examinations</p>

<p>Desirable:</p>

<p>Research experience in Molecular modeling and CADD will be given preference. UGC-NET/ CSIR-JRF qualified candidates will get preference.</p>

<p>The posts are purely on temporary basis. No TA/DA will be paid for attending the interview.</p>

<p>Advertisement: http://www.alagappauniversity.ac.in/files/news_files/new%20advt-UGC-16sept,13.doc</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</guid>
	<pubDate>Tue, 08 May 2018 04:52:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</link>
	<title><![CDATA[Metassembler: merging and optimizing de novo genome assemblies]]></title>
	<description><![CDATA[<p><span>Metassembler combines multiple whole genome de novo assemblies into a combined consensus assembly using the best segments of the individual assemblies.</span></p>
<p><span><span>Genome assembly projects typically run multiple algorithms in an attempt to find the single best assembly, although those assemblies often have complementary, if untapped, strengths and weaknesses. We present our metassembler algorithm that merges multiple assemblies of a genome into a single superior sequence.&nbsp;</span></span></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/metassembler/?source=directory" rel="nofollow">https://sourceforge.net/projects/metassembler/?source=directory</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4655/mathivanan-lab</guid>
  <pubDate>Fri, 20 Sep 2013 13:09:38 -0500</pubDate>
  <link></link>
  <title><![CDATA[Mathivanan Lab]]></title>
  <description><![CDATA[
<p>The major research interests are in exploring the role of extracellular matrix components (soluble secreted proteins and membrane vesicles) in cancer and intercellular communication. The lab integrates proteomic, genomic and bioinformatics methodologies to explore cancer cells. </p>

<p>More at http://www.mathivananlab.org/index.html</p>

<p>http://scholar.google.com/citations?user=U6PyEdYAAAAJ&amp;hl=en</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4706/junior-research-fellow-iit</guid>
  <pubDate>Sat, 21 Sep 2013 18:04:50 -0500</pubDate>
  <link></link>
  <title><![CDATA[Junior Research Fellow @ IIT]]></title>
  <description><![CDATA[
<p>Applications are invited from the citizens of India for filling up the following temporary position for the sponsored project undertaken in the Department of Biosciences and Bioengineering of this Institute. The position is temporary initially for a period of  1 Year  and tenable only for the duration of the project. The requisite qualification &amp; experience etc. are given below:<br /> <br />Project Code, Project Title &amp; Funding Agency<br />13DST016 : "Studies on the component of mimivirus DNA replication machinery" (Department of Science &amp; Technology)<br /> <br />Position &amp; Salary	<br />Junior Research Fellow (1 Post )<br />Consolidated salary <br /> Rs.16000/- p.m. + HRA<br />Qualification	<br />MSc or MTech or BTech or BE in one of the following branches with first class-Biochemistry, Microbiology, genetic Engineering, Biotechnology, Medical Microbiology, Bioinformatics, life sciences etc.<br />Job Profile	<br />Project involves virus culturing and purification, cloning, protein purification and measurement of helicase, primase, nuclease, translocase activities using various methods. Person should be highly motivated and some experience in cloning and protein purification is desirable. Experience in handling insect cell lines will be an added advantage.</p>

<p>More at http://www.ircc.iitb.ac.in/IRCC-Webpage/rnd/RecruitmentGenerateCircular.jsp?srno=2013086</p>
]]></description>
</item>

</channel>
</rss>