<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30207?offset=1250</link>
	<atom:link href="https://bioinformaticsonline.com/related/30207?offset=1250" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4656/pandey-lab</guid>
  <pubDate>Fri, 20 Sep 2013 13:19:18 -0500</pubDate>
  <link></link>
  <title><![CDATA[Pandey Lab]]></title>
  <description><![CDATA[
<p>The Pandey Lab at Johns Hopkins University is a Systems Biology lab that combines molecular biology, analytical chemistry and computational biology with various "Omics" technologies including genomics and proteomics to understand signaling pathways and to identify therapeutic targets and biomarkers in a number of cancers.</p>

<p>More at http://pandeylab.igm.jhmi.edu/</p>

<p>http://scholar.google.com/citations?user=OhuG0FcAAAAJ&amp;hl=en</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4873/vveks-lab</guid>
  <pubDate>Thu, 26 Sep 2013 11:11:39 -0500</pubDate>
  <link></link>
  <title><![CDATA[Vvek's Lab]]></title>
  <description><![CDATA[
<p>Broad Area of Research: RNA biology (microRNA, lncRNA), Stem cells, Functional genomics, Epigenomics and Cancer</p>

<p>RNAs, especially non-coding RNAs (such as microRNA, long ncRNAs) are recently identified to be very abundant in mammalian organisms and play some key roles in gene expression regulation, gene silencing, and also implicated in disease progression, stem cell pluripotency etc. Current research activities of our lab include analysis of expression pattern of ncRNAs by microarray and next-gen sequencing data and understanding the role of miRNAs or other regulatory RNAs in various diseases, especially cancer and validation by reporter assays (renilla/luciferase) and other experimental tools.</p>

<p>More @ http://vvekslab.in/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/5462/showreel-2008-cortical-studios</guid>
	<pubDate>Sat, 12 Oct 2013 18:33:40 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/5462/showreel-2008-cortical-studios</link>
	<title><![CDATA[Showreel 2008 - Cortical Studios]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/qrReqMKe7Xg" frameborder="0" allowfullscreen></iframe>We are a bioinformatics company that combines 3D animation, multimedia and scientific knowledge to meet your communication needs. With our academic background in the fields of biotechnology and molecular cellbiology and our computer expertise we provide cutting edge 3D animation productions for even the most complex projects. We translate complex scientific information into comprehensible artistic imagery in order to improve communication in the life sciences. Please feel free to contact us with any questions regarding the possibilities for your unique project.

Cortical Studios
Keizersgracht 8
1015 CN
Amsterdam
The Netherlands
info@corticalstudios.nl
www.corticalstudios.nl]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</guid>
	<pubDate>Fri, 26 Oct 2018 08:25:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</link>
	<title><![CDATA[MITOS: improved de novo metazoan mitochondrial genome annotation]]></title>
	<description><![CDATA[<p><span>Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.</span></p><p>Address of the bookmark: <a href="http://mitos.bioinf.uni-leipzig.de/index.py" rel="nofollow">http://mitos.bioinf.uni-leipzig.de/index.py</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7813/research-associate-indian-institute-of-spices-research</guid>
  <pubDate>Wed, 08 Jan 2014 10:10:03 -0600</pubDate>
  <link></link>
  <title><![CDATA[Research Associate @ INDIAN INSTITUTE OF SPICES RESEARCH]]></title>
  <description><![CDATA[
<p>INDIAN INSTITUTE OF SPICES RESEARCH<br />(Indian Council of Agricultural Research)<br />Marikunnu P.O., Kozhikode – 673 012, Kerala</p>

<p>Phone No. 0495 2731 410</p>

<p>WALK -IN- TEST CUM INTERVIEW<br />Walk- in- Test cum Interview (based on test) for the selection of Research Associate (Bioinformatics) &amp; Bioinformatic Trainees under the scheme ‘Distributed Information Sub Centre- DISC’ will be held at this Institute as per details indicated below.</p>

<p>Research Associate<br />Date of Interview : 21 -01-2014 at 10.00 A.M<br />Qualifications :<br />a) Essential: Doctorate degree in Bioinformatics or Biotechnology/Life Sciences/Biochemistry with expertise in  Bioinformatics as evidenced by publications.<br />OR Three years research experience after  MVSc/MPharm/ME/MTech with Bioinformatics Specialization.<br />b Desirable: Experience in handling NGS data  Programming skills in Python/Bioperl<br />Emoluments : Rs:22000/- per month + HRA  (higher pay upto Rs.24000/- can be paid depending on the qualifications and experience.<br />Upper age limit : 40 years for Men &amp; 45 years for Women as on date of Interview (Upper Age limits are relaxable for SC, ST and OBC candidates as per Govt. of India norms (at present 5 years for SC/ST and 3 years for OBC)<br />Duration of Project : Till the closure of the project.</p>

<p>General Terms and conditions<br />1. The above positions are purely on temporary basis and is co-terminus with the closure of the project. There is no provision of re-employment after termination of project.<br />The selected candidate will not have any right for claiming pay scale or absorption<br />against any regular post being vacant on a later date at this Institute.<br />2 . No TA/DA will be paid for attending the Interview.<br />3. Canvassing in any form will lead to cancellation of candidate.<br />4. The decision of Director, IISR would be final and binding in all aspects.<br />5. Candidates will not be permitted to enter the Examination Hall after 10.00 A.M.<br />6. Candidates who secure the minimum marks prescribed by the Institute in written test  only will be eligible for calling for the interview. The number of candidates to be  called for the interview will be decided by the Director of the Institute.<br />7 Those who do not possess original Degree/PG certificate or Provisional certificate will not be allowed to attend the Test/Interview.</p>

<p>Note: All relevant certificates (in original) and bio data, No objection certificate in case he/she is employed elsewhere and experience certificate in original (if any) need to be produced at the time of interview.<br />Advertisement: http://spicebioinfo.res.in/downloads/DISC-Website.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</guid>
	<pubDate>Fri, 09 Nov 2018 13:50:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</link>
	<title><![CDATA[ASCIIGenome: genome browser based on command line interface and designed for running from console terminals.]]></title>
	<description><![CDATA[<p><code>ASCIIGenome</code>&nbsp;is a genome browser based on command line interface and designed for running from console terminals.</p>
<p>Since&nbsp;<code>ASCIIGenome</code>&nbsp;does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like&nbsp;<a href="https://www.broadinstitute.org/igv/">IGV</a>.</p>
<p><span>Documentation</span>&nbsp;is at&nbsp;<a href="http://asciigenome.readthedocs.io/en/latest/">readthedocs/asciigenome</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/dariober/ASCIIGenome" rel="nofollow">https://github.com/dariober/ASCIIGenome</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4947/experimental-scientific-officer-bioinformatics</guid>
  <pubDate>Fri, 27 Sep 2013 11:09:44 -0500</pubDate>
  <link></link>
  <title><![CDATA[Experimental Scientific Officer (Bioinformatics)]]></title>
  <description><![CDATA[
<p>Closing Date:  8 October 2013</p>

<p>Salary:   £27,854 - £29,541, with progression to £36,298</p>

<p>You will perform cutting edge computational biology within the Faculty of Medical Sciences, with a particular focus on the Northern Institute for Cancer Research (NICR), and contribute to the delivery of Faculty wide programmes of training, analytical services and skill transfer between Faculty Institutes.</p>

<p>You will have a relevant first degree or equivalent qualifications and/or experience in a relevant scientific/technical role, together with previous specialist experience at a senior level in bioinformatics. A PhD is desirable.</p>

<p>This position is part of the Bioinformatics Support Unit but physically located for the majority of the time in the NICR buildings.</p>

<p>Tenable for three years.</p>

<p>Informal enquiries to unit head Dr Simon Cockell: 0191 222 7253; simon.cockell@ncl.ac.uk</p>

<p>For more information visit @ https://www15.i-grasp.com/fe/tpl_newcastle02.asp?s=4A515F4E5A565B1A&amp;jobid=50667,2552984041&amp;key=70203469&amp;c=725434237887&amp;pagestamp=sepghtjhowdqpsxuyn</p>

<p>You can also find several other jobs @http://bsu.ncl.ac.uk/support/recruitment/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</guid>
	<pubDate>Wed, 12 Dec 2018 08:33:41 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</link>
	<title><![CDATA[genoPlotR - plot gene and genome maps project!]]></title>
	<description><![CDATA[<p>genoPlotR is a R package to produce reproducible, publication-grade graphics of gene and genome maps. It allows the user to read from usual format such as protein table files and blast results, as well as home-made tabular files.</p>
<h3>Features</h3>
<ul>
<li>Linear representation of several segments of DNA</li>
<li>Comparisons represented by areas between the segments (like Artemis, for example)</li>
<li>Reads from common formats: Genbank, EMBL, blast, Mauve, and from user-generated tab files</li>
<li>Plot several subsegments of the same segment on the same line, separated by a //</li>
<li>Automatic or manual placement of the segments on the plot</li>
<li>Add annotations to all the lines</li>
<li>Create smart, automatic annotations for genomes, based on gene names</li>
<li>Add a user-generated tree</li>
<li>Add a global scale or a scale to each line</li>
<li>Use user-defined graphical functions to represent genes</li>
<li></li>
</ul><p>Address of the bookmark: <a href="http://genoplotr.r-forge.r-project.org/" rel="nofollow">http://genoplotr.r-forge.r-project.org/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>

</channel>
</rss>