Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Monthly fellowship (in rupee): 5,000/-

Traineeship

First Class M.Sc Bioinformatics/ Biotechnology/ Botany

Studentship: 5,000/-

M.Phil/M.Tech Bioinformatics/ Biotechnology/ any branch of Life Science students for doing their thesis work in the area of Bioinformatics.

Age limit as on 1.1.2015, 28 years. Age relaxation will be provided for SC, ST, OBC candidates as per Govt. norms.

Interested candidates may appear for walk-in-interview on 16th June 2015 at 10.30 am at JNTBGRI, Palode, Thiruvananthapuram. The candidate should report to the Office at Palode before 10.00 am

More at http://www.jntbgri.in/jntbgri/news/File0001.pdf

Sr Research Fellow & Technical Asst Posts: Indian Institute of Maize Research (IIMR), New Delhi has advertised a notification for the recruitment of Senior Research Fellow & Technical Assistant vacancies for the project titled “Genetic modifications to improve biological nitrogen fixation for augmenting nitrogen needs of cereals” on contractual basis. Eligible candidates may apply in prescribed application format on or before 25-06-2015. Other details like age, educational qualification, selection process, how to apply are given below…

Indian Institute of Maize Research Vacancy Details:
Total No. of Posts: 03
Name of the Posts :
1. Senior Research Fellow: 02 Posts
2. Technical Assistant: 01 Post

Age Limit: Candidates age should be 35 years for Senior Research Fellow, Minimum 21 years and maximum 45 years for Technical Assistant as on the closing date of the application. Age relaxation is 5 years to SC/ST and women candidates and 3 years to OBC candidates as per ICAR rules.

Educational Qualification: Candidates should possess Post graduate degree in Biotechnology/ Molecular Biology/ Bioinformatics/ Plant physiology for Senior Research fellow, Graduate degree in Agriculture/ Biotechnology/ any discipline of life sciences for Technical Assistant with relevant experience.

Selection Process: Candidates will be selected based on their performance in interview.

How to Apply: Eligible candidates can send their application in prescribed format along with bio-data to Dr. Pranjal Yadava, Principal Investigator, ICAR Indian Institute of Maize Research, Pusa Campus, New Delhi-110012 or mail to pranjal.yadava@gmail.com on or before 25-06-2015 & attend the interview along with application in the attached format at the time of interview, one passport size photograph, self attested copies of certificates for age, and qualifications, reprints of publications and ‘No Objection Certificate’, original documents on 01-07-2015. Venue details are mentioned below.

Important Dates:
Last Date for Receipt of Application: 25-06-2015
Date & Time of Interview : 01-07-2015.
Venue: IIMR, Pusa Campus, New Delhi

Eligibility : BE/B.Tech(CSE, ECE, IT)

Location : Pondicherry

Last Date : 26 Jun 2015

Hiring Process : Face to Face Interview
Pondicherry University - Job DetailsDate of posting:19 May 15

Senior Technical Assistant Job position in Pondicherry University on temporary basis

Project Title : "Bioinformatics National Certification (BINC) for certifying quality human resource in Bioinformatics"

Qualification : i) B.E/ B.Tech Computer Science/ Electronics & Communication Engineering/ Information Technology with 55% or equivalent marks. ii) One year Experience in relevant field in Government/ Public Sector or reputed Private Organizations. Desirable : Working experience in JSP and ASP/PHP

No. of Post : 01

Department : Biotechnology

Pay : Rs. 27,800/-

Age Limit : 30 Yrs
How to apply

Both above-mentioned posts are purely on temporary basis, extended by one year based on performance and will be terminated with the completion of BINC Program at Pondicherry University. Interested Candidates may send their application in the prescribed format with self-attested copies of all mark sheets and certificates to Dr. Basant K. Tiwary, Coordinator (BINC), Centre for Bioinformatics, Pondicherry University, Puducherry-605 014 before June 26, 2015.

Click Here http://www.pondiuni.edu.in/news/requirement-post-one-senior-technical-assistant-one-computer-assistant-–-dept-biotechnologygove

Starting 15th July 2015, the position relates to a project specifically for in silico drug docking, screening, design, optimisation and linkage with active chemists.

Experience in many docking softwares and operating systems is essential.

Additional experience in bioinformatics and computational biology tools will be useful.

Submit curriculum vitae to: sb.icgeb@gmail.com

Closing date: 5 July 2015

The OpenCPU JavaScript client library provides the most seamless integration of R and JavaScript available today.

OpenCPU uses standard R packaging to develop, ship and deploy web applications. Several open source example apps are available from Github.

Installing your own OpenCPU server is super easy and only takes a few minutes.

More at https://www.opencpu.org/