<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30234?offset=1000</link>
	<atom:link href="https://bioinformaticsonline.com/related/30234?offset=1000" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/11611/ten-recommendations-for-creating-usable-bioinformatics-command-line-software</guid>
	<pubDate>Sun, 08 Jun 2014 10:06:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/11611/ten-recommendations-for-creating-usable-bioinformatics-command-line-software</link>
	<title><![CDATA[Ten recommendations for creating usable bioinformatics command line software]]></title>
	<description><![CDATA[<p><span>Bioinformatics software varies greatly in quality. In terms of usability, the command line interface is the first experience a user will have of a tool. Unfortunately, this is often also the last time a tool will be used. Here I present ten recommendations for command line software author&rsquo;s tools to follow, which I believe would greatly improve the uptake and usability of their products, waste less user&rsquo;s time, and improve the quality of scientific analyses.</span></p><p>Address of the bookmark: <a href="http://www.gigasciencejournal.com/content/2/1/15?utm_content=buffer25ee0&amp;utm_medium=social&amp;utm_source=twitter.com&amp;utm_campaign=buffer" rel="nofollow">http://www.gigasciencejournal.com/content/2/1/15?utm_content=buffer25ee0&amp;utm_medium=social&amp;utm_source=twitter.com&amp;utm_campaign=buffer</a></p>]]></description>
	<dc:creator>RAJESH DETROJA</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35135/alitv%E2%80%94interactive-visualization-of-whole-genome-comparisons</guid>
	<pubDate>Wed, 10 Jan 2018 07:08:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35135/alitv%E2%80%94interactive-visualization-of-whole-genome-comparisons</link>
	<title><![CDATA[AliTV—interactive visualization of whole genome comparisons]]></title>
	<description><![CDATA[<p>AliTV, which provides interactive visualization of whole genome alignments. AliTV reads multiple whole genome alignments or automatically generates alignments from the provided data. Optional feature annotations and phylo- genetic information are supported. The user-friendly, web-browser based and highly customizable interface allows rapid exploration and manipulation of the visualized data as well as the export of publication-ready high-quality figures. AliTV is freely available at&nbsp;<a href="https://github.com/AliTVTeam/AliTV">https://github.com/AliTVTeam/AliTV</a></p>
<p>https://alitvteam.github.io/AliTV/</p><p>Address of the bookmark: <a href="https://github.com/AliTVTeam/AliTV" rel="nofollow">https://github.com/AliTVTeam/AliTV</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</guid>
	<pubDate>Wed, 07 Feb 2018 10:44:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</link>
	<title><![CDATA[GenomeTools: The versatile open source genome analysis software]]></title>
	<description><![CDATA[<p>The&nbsp;<em>GenomeTools</em>&nbsp;genome analysis system is a&nbsp;<a href="http://genometools.org/license.html">free</a>&nbsp;collection of bioinformatics&nbsp;<a href="http://genometools.org/tools.html">tools</a>&nbsp;(in the realm of genome informatics) combined into a single binary named&nbsp;<em>gt</em>. It is based on a C library named &ldquo;libgenometools&rdquo; which consists of several modules.</p>
<p>If you are interested in gene prediction, have a look at&nbsp;<a href="http://genomethreader.org/" title="GenomeThreader gene prediction        software"><em>GenomeThreader</em></a>.</p><p>Address of the bookmark: <a href="http://genometools.org/" rel="nofollow">http://genometools.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12567/workshop-on-molecular-modeling-and-dynamics-simulation-analyses</guid>
  <pubDate>Fri, 04 Jul 2014 13:38:13 -0500</pubDate>
  <link></link>
  <title><![CDATA[Workshop On Molecular Modeling and Dynamics Simulation Analyses]]></title>
  <description><![CDATA[
<p>Workshop On Molecular Modeling and Dynamics Simulation Analyses</p>

<p>August1-2, 2014</p>

<p>Organised By</p>

<p>Centre of Excellence in Bioinformatics<br />Bioinformatics Infrastructure Facility<br />Department of Biochemistry<br />University of Lucknow<br />Lucknow-226007</p>

<p>Course Contents</p>

<p>Molecular Modeling<br /> Homology Modeling<br />Molecular Docking<br />Post-structural Analyses</p>

<p>Molecular Dynamics (MD)<br />Simulation<br />Linux Introduction<br />Gromacs Installation</p>

<p>MD Simulation of Protein ligand complex<br />Analyses of MD<br />Trajectories<br />Visualization of Dynamic<br />complexes</p>

<p>Important Dates</p>

<p>Registration Begins June 25, 2014<br />Registration Closes July 25, 2014</p>

<p>Brochure : www.lkouniv.ac.in/conference/Brochure_August,%202014.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</guid>
	<pubDate>Tue, 17 Apr 2018 16:21:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</link>
	<title><![CDATA[AlignGraph: algorithm for secondary de novo genome assembly guided by closely related references]]></title>
	<description><![CDATA[<p>AlignGraph is a software that extends and joins contigs or scaffolds by reassembling them with help provided by a reference genome of a closely related organism.</p>
<p>Using AlignGraph</p>
<pre><code>AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]</code></pre>
<h3>&nbsp;</h3><p>Address of the bookmark: <a href="https://github.com/baoe/AlignGraph" rel="nofollow">https://github.com/baoe/AlignGraph</a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12940/ra-at-iiser-kolkata-computational-biologybioinformatics</guid>
  <pubDate>Wed, 23 Jul 2014 06:24:28 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA at IISER Kolkata Computational Biology/Bioinformatics]]></title>
  <description><![CDATA[
<p>Applications are invited from suitable candidates for research associate (post-doc; Rs. 22000-32000)/research fellow (16000-18000)/project assistant (Rs. 10000-14000) positions in the Department of Biological Sciences, Indian Institute for Science Education and Research Kolkata in the extramural project. Condition to satisfactory performance, the positions is for a period of upto 2 years (or funding of the project).</p>

<p>Brief description: We are looking for suitable candidates in the area o computational biology/bioinformatics/genomics or related field for next-generation sequencing (NGS) data analysis for small-RNAs, RNA-Seq and targeted resequencing of plants and associated organisms. We are an interdisciplinary group where projects equally involve bioinformatics and systems biology (specially microarrays and next-generation sequencing (NGS) data analysis and its use), along with plant molecular biology, genetic engineering, field biology, and analytical plant chemistry for understanding response of plants to biotic stresses.</p>

<p>Essential qualification: MSc/BTech/MTech/PhD (or other suitable qualification) in disciplines preferable to bioinformatics, computational biology, computer application (or equivalent)/ ‘Advance Post-Graduate Diploma in Bioinformatics’. Proficiency in programming languages (such as Perl, C++) and/or statistics (proficient in R for example) is compulsory.</p>

<p>Desirable qualification: Experience in the field of genomics e.g. microarray analysis, NGS, genome annotation, database development and management, software development, systems and network biology (or related fields) will be preferred.</p>

<p>Application process: Applications should contain CV along with brief description (maximum 1 page) of research conducted (highlighting skills and experience) till now. Applications should be sent by e-mail to Shree Prakash Pandey, Department of Biological Sciences, Indian Institute of Science Education and Research Kolkata, Mohanpur Campus, WB, India within 14 days of this advertisement.</p>

<p>E-mail: sppiiserkol@gmail.com, sppandey@iiserkol.ac.in</p>

<p>Advertisement:</p>

<p>http://www.iiserkol.ac.in/announcements/adverts/671-advt_ra_shree_prakash_july_2014</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/13226/you-and-your-friend-have-similar-dna</guid>
	<pubDate>Sun, 27 Jul 2014 20:44:05 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/13226/you-and-your-friend-have-similar-dna</link>
	<title><![CDATA[You and your friend have similar DNA !!!]]></title>
	<description><![CDATA[<p>New research out of Massachusetts claims that people often choose friends that are similar to them in genetics and they are more accurate than you might suppose. A study published on PNAS&nbsp;http://www.pnas.org/content/111/Supplement_3/10796.full found that people are apt to pick friends who are genetically similar to themselves - so much so that friends tend to be as alike at the genetic level as a person's fourth cousin.</p><div style="text-align: center;"><img src="http://i.kinja-img.com/gawker-media/image/upload/s--CwLwHa43--/18fbmlokxcmqcjpg.jpg" alt="image" width="300" height="271" style="border: 0px; border: 0px;"></div><p>Scientists with a long-running Framingham Heart Study looked at 1,932 people (examination of about 1.5 million markers of genetic variations), comparing unrelated friends to unrelated strangers. They found that friends shared about 1% of their genes &mdash; a percentage much higher than those shared with strangers.This new findings made it clear that people have more DNA in common with those who are selected as friends than with strangers in the same population.&nbsp;</p><p>The genes that lined up the most were olfactory genes, which deal with smell. The ones that lined up the least were immune system genes. The researchers weren't sure why that happened :/. Olfactory genes might be a straightforward explanation: People who like the same smells tend to be drawn to similar environments, where they meet others with the same tendencies.</p><p>Reference:</p><p>http://www.pnas.org/content/111/Supplement_3/10796.full</p><p>Image : http://i.kinja-img.com</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>