<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30236?offset=1000</link>
	<atom:link href="https://bioinformaticsonline.com/related/30236?offset=1000" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22437/jrf-bioinformatics-icar-national-research-centre-for-orchids-pakyong</guid>
  <pubDate>Thu, 28 May 2015 19:33:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF Bioinformatics @ ICAR - National Research Centre for Orchids  Pakyong]]></title>
  <description><![CDATA[
<p>ICAR - National Research Centre for Orchids</p>

<p>Pakyong</p>

<p>F.No:NRCO/Admn/DBT /136 /</p>

<p>Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.</p>

<p>‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”</p>

<p>Junior Research Fellow (One post)</p>

<p>Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.</p>

<p>Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques</p>

<p>2nd June 2015</p>

<p>Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36758/pbalign-maps-pacbio-reads-to-reference-sequences-and-saves-alignments-to-a-bam-file</guid>
	<pubDate>Thu, 24 May 2018 10:06:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36758/pbalign-maps-pacbio-reads-to-reference-sequences-and-saves-alignments-to-a-bam-file</link>
	<title><![CDATA[pbalign: maps PacBio reads to reference sequences and saves alignments to a BAM file]]></title>
	<description><![CDATA[pbalign aligns PacBio reads to reference sequences, filters aligned reads according to user-specific filtering criteria, and converts the output to either the SAM format or PacBio Compare HDF5 (e.g., .cmp.h5) format. The output Compare HDF5 file will be compatible with Quiver if --forQuiver option is specified.<p>Address of the bookmark: <a href="https://github.com/PacificBiosciences/pbalign" rel="nofollow">https://github.com/PacificBiosciences/pbalign</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37225/installing-trinity</guid>
	<pubDate>Tue, 03 Jul 2018 04:31:15 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37225/installing-trinity</link>
	<title><![CDATA[Installing Trinity !]]></title>
	<description><![CDATA[
<p>Download this https://github.com/trinityrnaseq/trinityrnaseq/releases/tag/Trinity-v2.6.6</p>

<p>➜ cd trinityrnaseq-Trinity-v2.6.6</p>

<p>➜  trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ make<br />Using gnu compiler for Inchworm and Chrysalis<br />cd Inchworm &amp;&amp; (test -e configure || autoreconf) \<br />                &amp;&amp; sh ./configure --prefix=`pwd`  &amp;&amp; make install<br />checking for a BSD-compatible install... /usr/bin/install -c<br />checking whether build environment is sane... yes<br />checking for a thread-safe mkdir -p... /bin/mkdir -p<br />checking for gawk... gawk<br />checking whether make sets $(MAKE)... yes<br />checking for g++... g++<br />checking whether the C++ compiler works... yes<br />checking for C++ compiler default output file name... a.out<br />checking for suffix of executables... <br />checking whether we are cross compiling... no<br />checking for suffix of object files... o<br />checking whether we are using the GNU C++ compiler... yes<br />checking whether g++ accepts -g... yes<br />checking for style of include used by make... GNU<br />checking dependency style of g++... gcc3<br />checking for library containing cos... none required<br />configure: creating ./config.status<br />config.status: creating Makefile<br />config.status: creating src/Makefile<br />config.status: creating config.h<br />config.status: config.h is unchanged<br />config.status: executing depfiles commands<br />make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />Making install in src<br />make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Fasta_entry.o -MD -MP -MF .deps/Fasta_entry.Tpo -c -o Fasta_entry.o Fasta_entry.cpp<br />mv -f .deps/Fasta_entry.Tpo .deps/Fasta_entry.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT IRKE_run.o -MD -MP -MF .deps/IRKE_run.Tpo -c -o IRKE_run.o IRKE_run.cpp<br />mv -f .deps/IRKE_run.Tpo .deps/IRKE_run.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT sequenceUtil.o -MD -MP -MF .deps/sequenceUtil.Tpo -c -o sequenceUtil.o sequenceUtil.cpp<br />mv -f .deps/sequenceUtil.Tpo .deps/sequenceUtil.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT IRKE.o -MD -MP -MF .deps/IRKE.Tpo -c -o IRKE.o IRKE.cpp<br />mv -f .deps/IRKE.Tpo .deps/IRKE.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT KmerCounter.o -MD -MP -MF .deps/KmerCounter.Tpo -c -o KmerCounter.o KmerCounter.cpp<br />mv -f .deps/KmerCounter.Tpo .deps/KmerCounter.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT string_util.o -MD -MP -MF .deps/string_util.Tpo -c -o string_util.o string_util.cpp<br />mv -f .deps/string_util.Tpo .deps/string_util.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Fasta_reader.o -MD -MP -MF .deps/Fasta_reader.Tpo -c -o Fasta_reader.o Fasta_reader.cpp<br />mv -f .deps/Fasta_reader.Tpo .deps/Fasta_reader.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT stacktrace.o -MD -MP -MF .deps/stacktrace.Tpo -c -o stacktrace.o stacktrace.cpp<br />mv -f .deps/stacktrace.Tpo .deps/stacktrace.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT argProcessor.o -MD -MP -MF .deps/argProcessor.Tpo -c -o argProcessor.o argProcessor.cpp<br />mv -f .deps/argProcessor.Tpo .deps/argProcessor.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o inchworm Fasta_entry.o IRKE_run.o sequenceUtil.o IRKE.o KmerCounter.o string_util.o Fasta_reader.o stacktrace.o argProcessor.o  <br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT cigar_tweaker.o -MD -MP -MF .deps/cigar_tweaker.Tpo -c -o cigar_tweaker.o cigar_tweaker.cpp<br />mv -f .deps/cigar_tweaker.Tpo .deps/cigar_tweaker.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT SAM_entry.o -MD -MP -MF .deps/SAM_entry.Tpo -c -o SAM_entry.o SAM_entry.cpp<br />mv -f .deps/SAM_entry.Tpo .deps/SAM_entry.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT SAM_reader.o -MD -MP -MF .deps/SAM_reader.Tpo -c -o SAM_reader.o SAM_reader.cpp<br />mv -f .deps/SAM_reader.Tpo .deps/SAM_reader.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Cigar.o -MD -MP -MF .deps/Cigar.Tpo -c -o Cigar.o Cigar.cpp<br />mv -f .deps/Cigar.Tpo .deps/Cigar.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o cigar_tweaker cigar_tweaker.o SAM_entry.o sequenceUtil.o SAM_reader.o Cigar.o string_util.o stacktrace.o Fasta_reader.o Fasta_entry.o  <br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT pull_reads_with_kmers.o -MD -MP -MF .deps/pull_reads_with_kmers.Tpo -c -o pull_reads_with_kmers.o pull_reads_with_kmers.cpp<br />mv -f .deps/pull_reads_with_kmers.Tpo .deps/pull_reads_with_kmers.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o pull_reads_with_kmers pull_reads_with_kmers.o Fasta_reader.o Fasta_entry.o sequenceUtil.o KmerCounter.o string_util.o stacktrace.o argProcessor.o  <br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT FastaToDeBruijn.o -MD -MP -MF .deps/FastaToDeBruijn.Tpo -c -o FastaToDeBruijn.o FastaToDeBruijn.cpp<br />FastaToDeBruijn.cpp: In function ‘void createGraphPerRecord(std::vector &gt;, int, bool, ArgProcessor)’:<br />FastaToDeBruijn.cpp:199:39: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                 if (seq_region.size() &lt; kmer_length) { continue; }  // can be e<br />                                       ^<br />mv -f .deps/FastaToDeBruijn.Tpo .deps/FastaToDeBruijn.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT DeBruijnGraph.o -MD -MP -MF .deps/DeBruijnGraph.Tpo -c -o DeBruijnGraph.o DeBruijnGraph.cpp<br />mv -f .deps/DeBruijnGraph.Tpo .deps/DeBruijnGraph.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o FastaToDeBruijn FastaToDeBruijn.o argProcessor.o Fasta_reader.o Fasta_entry.o sequenceUtil.o string_util.o stacktrace.o DeBruijnGraph.o  <br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT fastaToKmerCoverageStats.o -MD -MP -MF .deps/fastaToKmerCoverageStats.Tpo -c -o fastaToKmerCoverageStats.o fastaToKmerCoverageStats.cpp<br />fastaToKmerCoverageStats.cpp: In function ‘void populate_kmer_counter_from_reads(KmerCounter&amp;, std::__cxx11::string&amp;)’:<br />fastaToKmerCoverageStats.cpp:226:18: warning: unused variable ‘kmer_length’ [-Wunused-variable]<br />     unsigned int kmer_length = kcounter.get_kmer_length();<br />                  ^<br />mv -f .deps/fastaToKmerCoverageStats.Tpo .deps/fastaToKmerCoverageStats.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o fastaToKmerCoverageStats fastaToKmerCoverageStats.o argProcessor.o Fasta_reader.o Fasta_entry.o sequenceUtil.o string_util.o stacktrace.o KmerCounter.o  <br />make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'<br />test -z "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin" || /bin/mkdir -p "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin"<br />  /usr/bin/install -c inchworm cigar_tweaker pull_reads_with_kmers FastaToDeBruijn fastaToKmerCoverageStats '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin'<br />make[3]: Nothing to be done for 'install-data-am'.<br />make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'<br />make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'<br />make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />make[3]: Nothing to be done for 'install-exec-am'.<br />make[3]: Nothing to be done for 'install-data-am'.<br />make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />cd Chrysalis &amp;&amp; make UNSUPPORTED=yes <br />make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Chrysalis'<br />./MakeDepend.cc: In member function ‘bool makefile_builder::dependency::operator&lt;(const makefile_builder::dependency&amp;) const’:<br />./MakeDepend.cc:93:47: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />                dependent_ == other.dependent_ &amp;&amp;<br />                                               ^<br />./MakeDepend.cc: In member function ‘bool makefile_builder::subdir_and_target::operator&lt;(const makefile_builder::subdir_and_target&amp;) const’:<br />./MakeDepend.cc:130:41: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />                subdir_ == other.subdir_ &amp;&amp;<br />                                         ^<br />./MakeDepend.cc: In function ‘int main(int, char**)’:<br />./MakeDepend.cc:223:20: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]<br />   char * options = "Ad:g:u:fh";<br />                    ^<br />./MakeDepend.cc: In member function ‘void makefile_builder::DumpDependencies(const string&amp;)’:<br />./MakeDepend.cc:491:46: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />       if ( ! this-&gt;FileIsSource( dependent ) &amp;&amp; ! this-&gt;FileIsHeader( dependent<br />                                              ^<br />./MakeDepend.cc:493:44: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />            this-&gt;FileIsHeader( dependent ) &amp;&amp; this-&gt;FileIsSource( provider ) ) <br />                                            ^<br />./MakeDepend.cc: In member function ‘bool makefile_builder::FileIsHeader(const string&amp;) const’:<br />./MakeDepend.cc:1339:32: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />   return ( filename.size() &gt; 2 &amp;&amp;<br />                                ^<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:04 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./aligns/KmerAlignCore.cc -o obj/aligns/KmerAlignCore.o<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:06 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/AACodons.cc -o obj/analysis/AACodons.o<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:09 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/BreakTransByPairs.cc -o obj/analysis/BreakTransByPairs.o<br />./analysis/BreakTransByPairs.cc: In function ‘int main(int, char**)’:<br />./analysis/BreakTransByPairs.cc:105:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />   for (i=0; i &gt; DeBruijnGraph::get_candidate_weldmers(kmer_int_type_t, int)’:<br />./analysis/DeBruijnGraph.cc:473:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (int i = 0; i &lt; left_extensions.size(); i++) {<br />                       ^<br />./analysis/DeBruijnGraph.cc:476:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (int j = 0; j &lt; right_extensions.size(); j++) {<br />                           ^<br />./analysis/DeBruijnGraph.cc: In member function ‘void DeBruijnGraph::recursively_construct_kmer_extensions(kmer_int_type_t, std::vector&amp;, std::vector &gt;&amp;, char, std::map&amp;, int)’:<br />./analysis/DeBruijnGraph.cc:513:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (int i = 0; i &lt; adjacent_kmers.size(); i++) {<br />                       ^<br />./analysis/DeBruijnGraph.cc:527:41: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         if (kmer_extension_chars.size() == flank_extension_length) {<br />                                         ^<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:30 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/sequenceUtil.cc -o obj/analysis/sequenceUtil.o<br />./analysis/sequenceUtil.cc: In function ‘bool contains_non_gatc(std::__cxx11::string)’:<br />./analysis/sequenceUtil.cc:33:20: warning: array subscript has type ‘char’ [-Wchar-subscripts]<br />  if (_base_to_int[c] &gt; 3)<br />                    ^<br />./analysis/sequenceUtil.cc: In function ‘kmer_int_type_t kmer_to_intval(std::__cxx11::string)’:<br />./analysis/sequenceUtil.cc:264:26: warning: array subscript has type ‘char’ [-Wchar-subscripts]<br />  int val = _base_to_int[c];<br />                          ^<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:31 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/stacktrace.cc -o obj/analysis/stacktrace.o<br />/bin/rm -f lib_BubbleUpClustering_temp.a<br />ar -qc  lib_BubbleUpClustering_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/BubbleUpClustering.o obj/analysis/DNAVector.o obj/analysis/DeBruijnGraph.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/sequenceUtil.o obj/analysis/stacktrace.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./BubbleUpClustering<br />g++ -ggdb3    -fopenmp  -o ./BubbleUpClustering  obj/analysis/BubbleUpClustering.o -L. -lm -pthread     -l_BubbleUpClustering_temp<br />/bin/rm lib_BubbleUpClustering_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:32 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/Chrysalis.cc -o obj/analysis/Chrysalis.o<br />./analysis/Chrysalis.cc: In function ‘int main(int, char**)’:<br />./analysis/Chrysalis.cc:384:28: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]<br />     system(command.c_str());<br />                            ^<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:35 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/TranscriptomeGraph.cc -o obj/analysis/TranscriptomeGraph.o<br />./analysis/TranscriptomeGraph.cc: In function ‘int TranscriptomeGraph(vecDNAVector&amp;, FILE*, int, bool)’:<br />./analysis/TranscriptomeGraph.cc:668:20: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (i=0; i&lt;=d.isize()-k; i++) {<br />                    ^<br />/bin/rm -f lib_Chrysalis_temp.a<br />ar -qc  lib_Chrysalis_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/Chrysalis.o obj/analysis/DNAVector.o obj/analysis/TranscriptomeGraph.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./Chrysalis<br />g++ -ggdb3    -fopenmp  -o ./Chrysalis  obj/analysis/Chrysalis.o -L. -lm -pthread     -l_Chrysalis_temp<br />/bin/rm lib_Chrysalis_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:39 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/CreateIwormFastaBundle.cc -o obj/analysis/CreateIwormFastaBundle.o<br />/bin/rm -f lib_CreateIwormFastaBundle_temp.a<br />ar -qc  lib_CreateIwormFastaBundle_temp.a obj/analysis/AACodons.o obj/analysis/CreateIwormFastaBundle.o obj/analysis/DNAVector.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./CreateIwormFastaBundle<br />g++ -ggdb3    -fopenmp  -o ./CreateIwormFastaBundle  obj/analysis/CreateIwormFastaBundle.o -L. -lm -pthread     -l_CreateIwormFastaBundle_temp<br />/bin/rm lib_CreateIwormFastaBundle_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:42 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/GraphFromFasta.cc -o obj/analysis/GraphFromFasta.o<br />./analysis/GraphFromFasta.cc: In function ‘bool SimpleHalves(const DNAVector&amp;)’:<br />./analysis/GraphFromFasta.cc:255:15: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />               &amp;&amp; <br />               ^<br />./analysis/GraphFromFasta.cc: In function ‘void report_iworm_graph(std::map&lt;int, Pool&gt;&amp;, std::map&amp;)’:<br />./analysis/GraphFromFasta.cc:631:31: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />             for (int j = 0; j &lt; adjacent_nodes.size(); j++) {<br />                               ^<br />./analysis/GraphFromFasta.cc: In function ‘int main(int, char**)’:<br />./analysis/GraphFromFasta.cc:1164:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (i=0; i bubble_up_cluster_growth(std::map&amp;, std::map&amp;)’:<br />./GraphFromFasta_MPI.cc:706:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (int i = 0; i &lt; pool_vec.size(); i++) {<br />                       ^<br />./GraphFromFasta_MPI.cc:727:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (int i = 0; i &lt; pool_vec.size(); i++) {<br />                           ^<br />./GraphFromFasta_MPI.cc:834:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (int i = 0; i &lt; pool_vec.size(); i++) {<br />                       ^<br />./GraphFromFasta_MPI.cc: In function ‘void add_unclustered_iworm_contigs(svec&amp;, vecDNAVector&amp;)’:<br />./GraphFromFasta_MPI.cc:1144:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (size_t i = 0; i &lt; p.size(); i++) {<br />                              ^<br />./GraphFromFasta_MPI.cc: In function ‘int main(int, char**)’:<br />./GraphFromFasta_MPI.cc:1453:60: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />             if (iworm_counter % 1000 == 0 || iworm_counter == dna.size()-1) {<br />                                                            ^<br />./GraphFromFasta_MPI.cc:1458:24: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />             for (j=0; j&lt;=d.isize()-k; j++) {<br />                        ^<br />./GraphFromFasta_MPI.cc:1479:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                     if (c == i)<br />                           ^<br />./GraphFromFasta_MPI.cc:1503:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                     if (c == i)<br />                           ^<br />./GraphFromFasta_MPI.cc:2235:24: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />             for (j=0; j&lt;=d.isize()-k; j++) {<br />                        ^<br />./GraphFromFasta_MPI.cc:2264:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                     if (c == i) {<br />                           ^<br />./GraphFromFasta_MPI.cc:2359:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                     if (c == i) {<br />                           ^<br />./GraphFromFasta_MPI.cc:2475:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (i=0; i&lt;clustered_pools.isize(); i++) {<br />                ^<br />./GraphFromFasta_MPI.cc:2483:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (size_t j = 0; j &lt; p.size(); j++) {<br />                              ^<br />./GraphFromFasta_MPI.cc:2496:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (size_t j = 0; j &lt; p.size(); j++) {<br />                              ^<br />/bin/rm -f lib_GraphFromFasta_MPI_temp.a<br />ar -qc  lib_GraphFromFasta_MPI_temp.a obj/GraphFromFasta_MPI.o obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/DeBruijnGraph.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/sequenceUtil.o obj/analysis/stacktrace.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./GraphFromFasta_MPI<br />g++ -ggdb3    -fopenmp  -o ./GraphFromFasta_MPI  obj/GraphFromFasta_MPI.o -L. -lm -pthread     -l_GraphFromFasta_MPI_temp<br />/bin/rm lib_GraphFromFasta_MPI_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:53 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/IsoformAugment.cc -o obj/analysis/IsoformAugment.o<br />./analysis/IsoformAugment.cc: In function ‘int main(int, char**)’:<br />./analysis/IsoformAugment.cc:87:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (j=0; j&lt;matchesLeft.isize(); j++) {<br />                ^<br />./analysis/IsoformAugment.cc:122:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (j=0; j&lt;matches.isize(); j++) {<br />                ^<br />/bin/rm -f lib_IsoformAugment_temp.a<br />ar -qc  lib_IsoformAugment_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/IsoformAugment.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./IsoformAugment<br />g++ -ggdb3    -fopenmp  -o ./IsoformAugment  obj/analysis/IsoformAugment.o -L. -lm -pthread     -l_IsoformAugment_temp<br />/bin/rm lib_IsoformAugment_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:56 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/JoinTransByPairs.cc -o obj/analysis/JoinTransByPairs.o<br />./analysis/JoinTransByPairs.cc: In function ‘int main(int, char**)’:<br />./analysis/JoinTransByPairs.cc:293:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />   for (i=0; i&lt;dna.size(); i++) {<br />              ^<br />./analysis/JoinTransByPairs.cc:341:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />   for (i=0; i&lt;dna.size(); i++) {<br />              ^<br />/bin/rm -f lib_JoinTransByPairs_temp.a<br />ar -qc  lib_JoinTransByPairs_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/JoinTransByPairs.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./JoinTransByPairs<br />g++ -ggdb3    -fopenmp  -o ./JoinTransByPairs  obj/analysis/JoinTransByPairs.o -L. -lm -pthread     -l_JoinTransByPairs_temp<br />/bin/rm lib_JoinTransByPairs_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:00 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/QuantifyGraph.cc -o obj/analysis/QuantifyGraph.o<br />/bin/rm -f lib_QuantifyGraph_temp.a<br />ar -qc  lib_QuantifyGraph_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/QuantifyGraph.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./QuantifyGraph<br />g++ -ggdb3    -fopenmp  -o ./QuantifyGraph  obj/analysis/QuantifyGraph.o -L. -lm -pthread     -l_QuantifyGraph_temp<br />/bin/rm lib_QuantifyGraph_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:03 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/ReadsToTranscripts.cc -o obj/analysis/ReadsToTranscripts.o<br />/bin/rm -f lib_ReadsToTranscripts_temp.a<br />ar -qc  lib_ReadsToTranscripts_temp.a obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/analysis/ReadsToTranscripts.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./ReadsToTranscripts<br />g++ -ggdb3    -fopenmp  -o ./ReadsToTranscripts  obj/analysis/ReadsToTranscripts.o -L. -lm -pthread     -l_ReadsToTranscripts_temp<br />/bin/rm lib_ReadsToTranscripts_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:09 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./ReadsToTranscripts_MPI.cc -o obj/ReadsToTranscripts_MPI.o<br />/bin/rm -f lib_ReadsToTranscripts_MPI_temp.a<br />ar -qc  lib_ReadsToTranscripts_MPI_temp.a obj/ReadsToTranscripts_MPI.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./ReadsToTranscripts_MPI<br />g++ -ggdb3    -fopenmp  -o ./ReadsToTranscripts_MPI  obj/ReadsToTranscripts_MPI.o -L. -lm -pthread     -l_ReadsToTranscripts_MPI_temp<br />/bin/rm lib_ReadsToTranscripts_MPI_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:14 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./ReadsToTranscripts_MPI_chang.cc -o obj/ReadsToTranscripts_MPI_chang.o<br />/bin/rm -f lib_ReadsToTranscripts_MPI_chang_temp.a<br />ar -qc  lib_ReadsToTranscripts_MPI_chang_temp.a obj/ReadsToTranscripts_MPI_chang.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./ReadsToTranscripts_MPI_chang<br />g++ -ggdb3    -fopenmp  -o ./ReadsToTranscripts_MPI_chang  obj/ReadsToTranscripts_MPI_chang.o -L. -lm -pthread     -l_ReadsToTranscripts_MPI_chang_temp<br />/bin/rm lib_ReadsToTranscripts_MPI_chang_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:18 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/RunButterfly.cc -o obj/analysis/RunButterfly.o<br />./analysis/RunButterfly.cc: In member function ‘void JobControl::ClearFiles()’:<br />./analysis/RunButterfly.cc:107:25: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]<br />       system(rm.c_str());<br />                         ^<br />./analysis/RunButterfly.cc: In member function ‘void JobControl::Submit()’:<br />./analysis/RunButterfly.cc:77:27: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]<br />    system(theCmmd.c_str());<br />                           ^<br />./analysis/RunButterfly.cc:85:27: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]<br />    system(theCmmd.c_str());   <br />                           ^<br />/bin/rm -f lib_RunButterfly_temp.a<br />ar -qc  lib_RunButterfly_temp.a obj/analysis/RunButterfly.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./RunButterfly<br />g++ -ggdb3    -fopenmp  -o ./RunButterfly  obj/analysis/RunButterfly.o -L. -lm -pthread     -l_RunButterfly_temp<br />/bin/rm lib_RunButterfly_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:23 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/TranscriptomeFromVaryK.cc -o obj/analysis/TranscriptomeFromVaryK.o<br />./analysis/TranscriptomeFromVaryK.cc: In function ‘int main(int, char**)’:<br />./analysis/TranscriptomeFromVaryK.cc:216:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (j=0; j&lt;=d.lsize()-k; j++) {<br />                ^<br />./analysis/TranscriptomeFromVaryK.cc:218:22: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />       for (int x=j; x&lt;j+k; x++) {<br />                      ^<br />/bin/rm -f lib_TranscriptomeFromVaryK_temp.a<br />ar -qc  lib_TranscriptomeFromVaryK_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/TranscriptomeFromVaryK.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./TranscriptomeFromVaryK<br />g++ -ggdb3    -fopenmp  -o ./TranscriptomeFromVaryK  obj/analysis/TranscriptomeFromVaryK.o -L. -lm -pthread     -l_TranscriptomeFromVaryK_temp<br />/bin/rm lib_TranscriptomeFromVaryK_temp.a<br />make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Chrysalis'<br />cd trinity-plugins &amp;&amp; make trinity_essentials<br />make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins'<br />tar xvf seqtk-trinity.v0.0.2.tar.gz<br />seqtk-trinity-0.0.2/<br />seqtk-trinity-0.0.2/.gitignore<br />seqtk-trinity-0.0.2/LICENSE<br />seqtk-trinity-0.0.2/Makefile<br />seqtk-trinity-0.0.2/README.md<br />seqtk-trinity-0.0.2/khash.h<br />seqtk-trinity-0.0.2/kseq.h<br />seqtk-trinity-0.0.2/seqtk.c<br />seqtk-trinity-0.0.2/testing/<br />seqtk-trinity-0.0.2/testing/newformat_1.fq<br />seqtk-trinity-0.0.2/testing/newformat_2.fq<br />seqtk-trinity-0.0.2/testing/oldformat_1.fq<br />seqtk-trinity-0.0.2/testing/oldformat_2.fq<br />cd seqtk-trinity-0.0.2 &amp;&amp; make<br />make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/seqtk-trinity-0.0.2'<br />gcc -g -Wall -O2 -Wno-unused-function seqtk.c -o seqtk-trinity -lz -lm<br />seqtk.c: In function ‘stk_comp’:<br />seqtk.c:444:16: warning: variable ‘lc’ set but not used [-Wunused-but-set-variable]<br />    int la, lb, lc, na, nb, nc, cnt[11];<br />                ^<br />make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/seqtk-trinity-0.0.2'<br />mv seqtk-trinity-0.0.2/seqtk-trinity ./BIN/.<br />tar -zxvf "ParaFly-0.1.0".tar.gz &amp;&amp; \<br />cd "ParaFly-0.1.0" &amp;&amp; sh ./configure --prefix=`pwd` &amp;&amp; make install &amp;&amp; \<br />cp bin/ParaFly ../BIN/<br />ParaFly-0.1.0/<br />ParaFly-0.1.0/LICENSE<br />ParaFly-0.1.0/Makefile<br />ParaFly-0.1.0/Makefile.am<br />ParaFly-0.1.0/Makefile.in<br />ParaFly-0.1.0/README.md<br />ParaFly-0.1.0/aclocal.m4<br />ParaFly-0.1.0/bin/<br />ParaFly-0.1.0/bin/ParaFly<br />ParaFly-0.1.0/config.h<br />ParaFly-0.1.0/config.h.in<br />ParaFly-0.1.0/config.log<br />ParaFly-0.1.0/config.status<br />ParaFly-0.1.0/configure<br />ParaFly-0.1.0/configure.ac<br />ParaFly-0.1.0/depcomp<br />ParaFly-0.1.0/install-sh<br />ParaFly-0.1.0/missing<br />ParaFly-0.1.0/src/<br />ParaFly-0.1.0/src/.deps/<br />ParaFly-0.1.0/src/.deps/ParaFly.Po<br />ParaFly-0.1.0/src/.deps/argProcessor.Po<br />ParaFly-0.1.0/src/Makefile<br />ParaFly-0.1.0/src/Makefile.am<br />ParaFly-0.1.0/src/Makefile.in<br />ParaFly-0.1.0/src/ParaFly.cpp<br />ParaFly-0.1.0/src/argProcessor.cpp<br />ParaFly-0.1.0/src/argProcessor.hpp<br />ParaFly-0.1.0/stamp-h1<br />ParaFly-0.1.0/test/<br />ParaFly-0.1.0/test/Makefile<br />ParaFly-0.1.0/test/cmds.txt<br />ParaFly-0.1.0/test/rand_exit.pl<br />checking for a BSD-compatible install... /usr/bin/install -c<br />checking whether build environment is sane... yes<br />checking for a thread-safe mkdir -p... /bin/mkdir -p<br />checking for gawk... gawk<br />checking whether make sets $(MAKE)... yes<br />checking for g++... g++<br />checking for C++ compiler default output file name... a.out<br />checking whether the C++ compiler works... yes<br />checking whether we are cross compiling... no<br />checking for suffix of executables... <br />checking for suffix of object files... o<br />checking whether we are using the GNU C++ compiler... yes<br />checking whether g++ accepts -g... yes<br />checking for style of include used by make... GNU<br />checking dependency style of g++... gcc3<br />checking for library containing cos... none required<br />configure: creating ./config.status<br />config.status: creating Makefile<br />config.status: creating src/Makefile<br />config.status: creating config.h<br />config.status: config.h is unchanged<br />config.status: executing depfiles commands<br />make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />Making install in src<br />make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'<br />g++ -DHAVE_CONFIG_H -I. -I..    -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -MT ParaFly.o -MD -MP -MF .deps/ParaFly.Tpo -c -o ParaFly.o ParaFly.cpp<br />mv -f .deps/ParaFly.Tpo .deps/ParaFly.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -MT argProcessor.o -MD -MP -MF .deps/argProcessor.Tpo -c -o argProcessor.o argProcessor.cpp<br />mv -f .deps/argProcessor.Tpo .deps/argProcessor.Po<br />g++ -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2   -o ParaFly ParaFly.o argProcessor.o  <br />make[4]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'<br />test -z "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin" || /bin/mkdir -p "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin"<br />  /usr/bin/install -c ParaFly '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin'<br />make[4]: Nothing to be done for 'install-data-am'.<br />make[4]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'<br />make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'<br />make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />make[4]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />make[4]: Nothing to be done for 'install-exec-am'.<br />make[4]: Nothing to be done for 'install-data-am'.<br />make[4]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />ln -sf Trimmomatic-0.36 Trimmomatic<br />make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins'<br />sh ./util/support_scripts/trinity_install_tests.sh<br />~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~</p>

<p>Performing Unit Tests of Build<br /> <br />~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~<br />Inchworm:                has been Installed Properly<br />Chrysalis:               has been Installed Properly<br />QuantifyGraph:           has been Installed Properly<br />GraphFromFasta:          has been Installed Properly<br />ReadsToTranscripts:      has been Installed Properly<br />parafly:                 has been Installed Properly<br />➜  trinityrnaseq-Trinity-v2.6.6 git:(master) ✗<br />➜  trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ ./Trinity</p>

<p>###############################################################################<br />#</p>

<p>     ______  ____   ____  ____   ____  ______  __ __<br />    |      ||    \ |    ||    \ |    ||      ||  |  |<br />    |      ||  D  ) |  | |  _  | |  | |      ||  |  |<br />    |_|  |_||    /  |  | |  |  | |  | |_|  |_||  ~  |<br />      |  |  |    \  |  | |  |  | |  |   |  |  |___, |<br />      |  |  |  .  \ |  | |  |  | |  |   |  |  |     |<br />      |__|  |__|\_||____||__|__||____|  |__|  |____/</p>

<p>#<br />#<br /># Required:<br />#<br />#  --seqType &lt;string&gt;      :type of reads: ('fa' or 'fq')<br />#<br />#  --max_memory       :suggested max memory to use by Trinity where limiting can be enabled. (jellyfish, sorting, etc)<br />#                            provided in Gb of RAM, ie.  '--max_memory 10G'<br />#<br />#  If paired reads:<br />#      --left      :left reads, one or more file names (separated by commas, no spaces)<br />#      --right     :right reads, one or more file names (separated by commas, no spaces)<br />#<br />#  Or, if unpaired reads:<br />#      --single    :single reads, one or more file names, comma-delimited (note, if single file contains pairs, can use flag: --run_as_paired )<br />#<br />#  Or,<br />#      --samples_file          tab-delimited text file indicating biological replicate relationships.<br />#                                   ex.<br />#                                        cond_A    cond_A_rep1    A_rep1_left.fq    A_rep1_right.fq<br />#                                        cond_A    cond_A_rep2    A_rep2_left.fq    A_rep2_right.fq<br />#                                        cond_B    cond_B_rep1    B_rep1_left.fq    B_rep1_right.fq<br />#                                        cond_B    cond_B_rep2    B_rep2_left.fq    B_rep2_right.fq<br />#<br />#                      # if single-end instead of paired-end, then leave the 4th column above empty.<br />#<br />####################################<br />##  Misc:  #########################<br />#<br />#  --SS_lib_type           :Strand-specific RNA-Seq read orientation.<br />#                                   if paired: RF or FR,<br />#                                   if single: F or R.   (dUTP method = RF)<br />#                                   See web documentation.<br />#<br />#  --CPU                      :number of CPUs to use, default: 2<br />#  --min_contig_length        :minimum assembled contig length to report<br />#                                   (def=200)<br />#<br />#  --long_reads            :fasta file containing error-corrected or circular consensus (CCS) pac bio reads<br />#                                   (** note: experimental parameter **, this functionality continues to be under development)<br />#<br />#  --genome_guided_bam     :genome guided mode, provide path to coordinate-sorted bam file.<br />#                                   (see genome-guided param section under --show_full_usage_info)<br />#<br />#  --jaccard_clip                  :option, set if you have paired reads and<br />#                                   you expect high gene density with UTR<br />#                                   overlap (use FASTQ input file format<br />#                                   for reads).<br />#                                   (note: jaccard_clip is an expensive<br />#                                   operation, so avoid using it unless<br />#                                   necessary due to finding excessive fusion<br />#                                   transcripts w/o it.)<br />#<br />#  --trimmomatic                   :run Trimmomatic to quality trim reads<br />#                                        see '--quality_trimming_params' under full usage info for tailored settings.<br />#                                  <br />#<br />#  --no_normalize_reads            :Do *not* run in silico normalization of reads. Defaults to max. read coverage of 50.<br />#                                       see '--normalize_max_read_cov' under full usage info for tailored settings.<br />#                                       (note, as of Sept 21, 2016, normalization is on by default)<br />#     <br />#  --no_distributed_trinity_exec   :do not run Trinity phase 2 (assembly of partitioned reads), and stop after generating command list.<br />#<br />#<br />#  --output                :name of directory for output (will be<br />#                                   created if it doesn't already exist)<br />#                                   default( your current working directory: "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity_out_dir" <br />#                                    note: must include 'trinity' in the name as a safety precaution! )<br />#             <br />#  --workdir               :where Trinity phase-2 assembly computation takes place (defaults to --output setting).<br />#                                  (can set this to a node-local drive or RAM disk)     <br />#  <br />#  --full_cleanup                  :only retain the Trinity fasta file, rename as ${output_dir}.Trinity.fasta<br />#<br />#  --cite                          :show the Trinity literature citation<br />#<br />#  --verbose                       :provide additional job status info during the run.<br />#<br />#  --version                       :reports Trinity version (Trinity-v2.6.6) and exits.<br />#<br />#  --show_full_usage_info          :show the many many more options available for running Trinity (expert usage).<br />#<br />#<br />###############################################################################<br />#<br />#  *Note, a typical Trinity command might be:<br />#<br />#        Trinity --seqType fq --max_memory 50G --left reads_1.fq  --right reads_2.fq --CPU 6<br />#<br />#<br />#    and for Genome-guided Trinity:<br />#<br />#        Trinity --genome_guided_bam rnaseq_alignments.csorted.bam --max_memory 50G<br />#                --genome_guided_max_intron 10000 --CPU 6<br />#<br />#     see: /home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/sample_data/test_Trinity_Assembly/<br />#          for sample data and 'runMe.sh' for example Trinity execution<br />#<br />#     For more details, visit: http://trinityrnaseq.github.io<br />#<br />###############################################################################</p>
]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37457/nanofilt-filtering-and-trimming-of-long-read-sequencing-data</guid>
	<pubDate>Mon, 30 Jul 2018 12:01:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37457/nanofilt-filtering-and-trimming-of-long-read-sequencing-data</link>
	<title><![CDATA[nanofilt: Filtering and trimming of long read sequencing data]]></title>
	<description><![CDATA[<p>Filtering on quality and/or read length, and optional trimming after passing filters.<br>Reads from stdin, writes to stdout.</p>
<p>Intended to be used:</p>
<ul>
<li>directly after fastq extraction</li>
<li>prior to mapping</li>
<li>in a stream between extraction and mapping</li>
</ul>
<p>https://github.com/wdecoster/nanofilt</p><p>Address of the bookmark: <a href="https://github.com/wdecoster/nanofilt" rel="nofollow">https://github.com/wdecoster/nanofilt</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22778/sr-research-fellow-technical-asst-at-indian-institute-of-maize-research-india</guid>
  <pubDate>Wed, 17 Jun 2015 18:47:51 -0500</pubDate>
  <link></link>
  <title><![CDATA[Sr Research Fellow &amp; Technical Asst at Indian Institute of Maize Research - India]]></title>
  <description><![CDATA[
<p>Indian Institute of Maize Research Jobs 2015 –</p>

<p>Sr Research Fellow &amp; Technical Asst Posts: Indian Institute of Maize Research (IIMR), New Delhi has advertised a notification for the recruitment of Senior Research Fellow &amp; Technical Assistant vacancies for the project titled “Genetic modifications to improve biological nitrogen fixation for augmenting nitrogen needs of cereals” on contractual basis. Eligible candidates may apply in prescribed application format on or before 25-06-2015. Other details like age, educational qualification, selection process, how to apply are given below…</p>

<p>Indian Institute of Maize Research Vacancy Details:<br />Total No. of Posts: 03<br />Name of the Posts :<br />1. Senior Research Fellow: 02 Posts<br />2. Technical Assistant: 01 Post</p>

<p>Age Limit: Candidates age should be 35 years for Senior Research Fellow, Minimum 21 years and maximum 45 years for Technical Assistant as on the closing date of the application. Age relaxation is 5 years to SC/ST and women candidates and 3 years to OBC candidates as per ICAR rules.</p>

<p>Educational Qualification: Candidates should possess Post graduate degree in Biotechnology/ Molecular Biology/ Bioinformatics/ Plant physiology for Senior Research fellow, Graduate degree in Agriculture/ Biotechnology/ any discipline of life sciences for Technical Assistant with relevant experience.</p>

<p>Selection Process: Candidates will be selected based on their performance in interview.</p>

<p>How to Apply: Eligible candidates can send their application in prescribed format along with bio-data to Dr. Pranjal Yadava, Principal Investigator, ICAR Indian Institute of Maize Research, Pusa Campus, New Delhi-110012 or mail to pranjal.yadava@gmail.com on or before 25-06-2015 &amp; attend the interview along with application in the attached format at the time of interview, one passport size photograph, self attested copies of certificates for age, and qualifications, reprints of publications and ‘No Objection Certificate’, original documents on 01-07-2015. Venue details are mentioned below.</p>

<p>Important Dates:<br />Last Date for Receipt of Application: 25-06-2015<br />Date &amp; Time of Interview : 01-07-2015.<br />Venue: IIMR, Pusa Campus, New Delhi</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37957/base-a-practical-de-novo-assembler-for-large-genomes-using-long-ngs-reads</guid>
	<pubDate>Fri, 19 Oct 2018 07:25:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37957/base-a-practical-de-novo-assembler-for-large-genomes-using-long-ngs-reads</link>
	<title><![CDATA[BASE: a practical de novo assembler for large genomes using long NGS reads]]></title>
	<description><![CDATA[<p><span>new&nbsp;</span><em>de novo</em><span>&nbsp;assembler called BASE. It enhances the classic seed-extension approach by indexing the reads efficiently to generate adaptive seeds that have high probability to appear uniquely in the genome. Such seeds form the basis for BASE to build extension trees and then to use reverse validation to remove the branches based on read coverage and paired-end information, resulting in high-quality consensus sequences of reads sharing the seeds. Such consensus sequences are then extended to contigs.</span></p><p>Address of the bookmark: <a href="https://github.com/dhlbh/BASE" rel="nofollow">https://github.com/dhlbh/BASE</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22787/senior-technical-assistant-at-pondicherry-university</guid>
  <pubDate>Wed, 17 Jun 2015 20:46:12 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior Technical Assistant at Pondicherry University]]></title>
  <description><![CDATA[
<p>Senior Technical Assistant</p>

<p>Eligibility : BE/B.Tech(CSE, ECE, IT)</p>

<p>Location : Pondicherry</p>

<p>Last Date : 26 Jun 2015</p>

<p>Hiring Process : Face to Face Interview<br />Pondicherry University - Job DetailsDate of posting:19 May 15</p>

<p>Senior Technical Assistant Job position in Pondicherry University on temporary basis  </p>

<p>Project Title : "Bioinformatics National Certification (BINC) for certifying quality human resource in Bioinformatics"</p>

<p>Qualification : i) B.E/ B.Tech Computer Science/ Electronics &amp; Communication Engineering/ Information Technology with 55% or equivalent marks. ii) One year Experience in relevant field in Government/ Public Sector or reputed Private Organizations. Desirable : Working experience in JSP and ASP/PHP</p>

<p>No. of Post : 01</p>

<p>Department : Biotechnology</p>

<p>Pay : Rs. 27,800/- </p>

<p>Age Limit : 30 Yrs<br />How to apply</p>

<p>Both above-mentioned posts are purely on temporary basis, extended by one year based on performance and will be terminated with the completion of BINC Program at Pondicherry University. Interested Candidates may send their application in the prescribed format with self-attested copies of all mark sheets and certificates to Dr. Basant K. Tiwary, Coordinator (BINC), Centre for Bioinformatics, Pondicherry University, Puducherry-605 014 before June 26, 2015.</p>

<p>Click Here http://www.pondiuni.edu.in/news/requirement-post-one-senior-technical-assistant-one-computer-assistant-–-dept-biotechnologygove</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38829/nquire-a-statistical-framework-for-ploidy-estimation-using-ngs-short-read-data</guid>
	<pubDate>Thu, 31 Jan 2019 05:12:19 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38829/nquire-a-statistical-framework-for-ploidy-estimation-using-ngs-short-read-data</link>
	<title><![CDATA[nQuire: A statistical framework for ploidy estimation using NGS short-read data]]></title>
	<description><![CDATA[<p>nQuire implements a set of commands to estimate ploidy level of individuals from species, where recent polyploidization occurred and intraspecific ploidy variation is observed. Specifically, nQuire uses next-generation sequencing data to distinguish between diploids, triploids and tetraploids, on the basis of frequency distributions at variant sites where only two bases are segregating.</p>
<p>For more background see also the publication at&nbsp;<a href="https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2128-z">BMC Bioinformatics</a>.</p>
<p>https://github.com/clwgg/nQuire</p><p>Address of the bookmark: <a href="https://github.com/clwgg/nQuire" rel="nofollow">https://github.com/clwgg/nQuire</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>