<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30242?offset=1230</link>
	<atom:link href="https://bioinformaticsonline.com/related/30242?offset=1230" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8442/assistant-professor-king-saud-university-riyadh</guid>
  <pubDate>Fri, 21 Feb 2014 05:57:18 -0600</pubDate>
  <link></link>
  <title><![CDATA[Assistant Professor @ King Saud University Riyadh]]></title>
  <description><![CDATA[
<p>Qualifications: Candidates must have a Ph.D. and a strong background in Molecular and Cellular Biology, protein expression, FACS, or computational biology, and ability to work collaboratively.</p>

<p>This position will have a significant focus on providing analytical support for next generation sequencing data analysis – Exome-sequencing, Targetted sequencing as well as high-throughput genotyping on Illumina platform.</p>

<p>Job location:</p>

<p>Genome Research Chair<br />King Saud University, Riyadh-11451<br />KSA</p>

<p>Interested candidate may forward their CV to grcksu@gmail.com</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8466/srf-position-in-computational-systems-biology-computational-biology-group-iiit-delhi</guid>
  <pubDate>Sun, 23 Feb 2014 20:56:08 -0600</pubDate>
  <link></link>
  <title><![CDATA[SRF position in Computational Systems Biology Computational biology Group, IIIT-Delhi]]></title>
  <description><![CDATA[
<p>An opportunity to perform research in DST supported project that involves building of mathematical models to understand the functional relationship between circadian rhythms and memory formation under stressful condition.  In this project, mathematical model of circadian rhythms based on gene regulatory mechanisms will be unified with the mathematical model of calcium signal transduction pathway to understand and predict the formation of fear memory under stressful conditions. The research scholar will spend full time on this project to build new models and expected to contribute significantly to prepare the results for publication and presentation, and to contribute to grant proposals. </p>

<p>Required Qualifications: Masters in physics/chemistry/mathematics (or) MTech in bioengineering, chemical (or) Masters in any traditional field of science with outstanding performance throughout the program. Candidate should have cleared GATE/UGC-CSIR examinations. Applicant should have done basic mathematics courses like calculus, differential equations, numerical analysis etc in their degree program and have obtained good grades in those courses. Knowledge of MATLAB and C or at least one traditional programming language is absolutely necessary. Strong inclination to understand biological concepts is a must for this research work as this project is about modeling biological systems.     </p>

<p>Salary: A fixed salary of Rs 18000 PM including HRA will be paid. </p>

<p>Last date for application: This advertisement is open until suitable candidate is found for the project. </p>

<p>Preferred Qualifications:  - Expertise in dynamical systems theory, bifurcation theory, numerical simulations, parameter estimation. </p>

<p>Independence and high motivation for carrying out interdisciplinary research. - Excellent communication skills and ability to work independently. - Good working habits. </p>

<p>Interested candidates should submit both curriculum vitae and statement of interest in PDF format to sriramk@iiitd.ac.in and should clearly mention in the subject "Application for SRF".</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/12868/landry-lab</guid>
  <pubDate>Thu, 17 Jul 2014 14:33:57 -0500</pubDate>
  <link></link>
  <title><![CDATA[Landry Lab]]></title>
  <description><![CDATA[
<p>EVOLUTIONARY AND INTEGRATIVE CELL BIOLOGY</p>

<p>Our research is at the crossroad between cell biology, ecological genomics, systems biology, molecular evolution and population genetics. We study the architecture and evolution of protein and signalling networks.</p>

<p>More at http://landrylab.ibis.ulaval.ca/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</guid>
	<pubDate>Thu, 25 Oct 2018 09:38:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</link>
	<title><![CDATA[Scribl : HTML5 canvas genomics graphic library]]></title>
	<description><![CDATA[<p>Scribl is a javascript, Canvas-based graphics library that easily generates biological visuals of genomic regions, alignments, and assembly data. Scribl can also be used in conventional offline pipelines, since everything needed to generate charts can be contained in a single html file.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://chmille4.github.io/Scribl/" rel="nofollow">http://chmille4.github.io/Scribl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/8970/j-aires-de-sousa-research-group</guid>
  <pubDate>Wed, 12 Mar 2014 09:57:25 -0500</pubDate>
  <link></link>
  <title><![CDATA[J. Aires de Sousa Research Group]]></title>
  <description><![CDATA[
<p>We are involved in the development of methods and software in chemoinformatics. Current main projects are:</p>

<p>1.automatic learning of chemical reactivity and metabolism,<br />2.simulation of NMR spectra,<br />3.modelling of properties of ionic liquids, and<br />4.representation of molecular chirality.</p>

<p>More at http://joao.airesdesousa.com/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38166/pygenometracks-standalone-program-and-library-to-plot-beautiful-genome-browser-tracks</guid>
	<pubDate>Fri, 09 Nov 2018 12:34:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38166/pygenometracks-standalone-program-and-library-to-plot-beautiful-genome-browser-tracks</link>
	<title><![CDATA[pyGenomeTracks: Standalone program and library to plot beautiful genome browser tracks]]></title>
	<description><![CDATA[<p>pyGenomeTracks aims to produce high-quality genome browser tracks that are highly customizable. Currently, it is possible to plot:</p>
<ul>
<li>bigwig</li>
<li>bed (many options)</li>
<li>bedgraph</li>
<li>links (represented as arcs)</li>
<li>Hi-C matrices (if&nbsp;<a href="http://hicexplorer.readthedocs.io/">HiCExplorer</a>&nbsp;is installed)</li>
</ul><p>Address of the bookmark: <a href="https://github.com/deeptools/pyGenomeTracks" rel="nofollow">https://github.com/deeptools/pyGenomeTracks</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/9030/linux-ssh-client-commands-for-bioinformatics</guid>
	<pubDate>Thu, 13 Mar 2014 17:16:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/9030/linux-ssh-client-commands-for-bioinformatics</link>
	<title><![CDATA[Linux SSH Client Commands for Bioinformatics]]></title>
	<description><![CDATA[<p>Here come on let play with the following basic command line usage of the ssh client.<br /><br /><strong>1. Check your SSH Client Version:</strong><br /><br />Checking for your SSH client is very sare, but sometimes it may be necessary to identify the SSH client that you are currently running and it&rsquo;s corresponding version number. The SSh client can be identified as follows<br /><br />$ ssh -V<br />OpenSSH_3.9p1, OpenSSL 0.9.7a Feb 19 2013<br /><br />$ ssh -V<br />ssh: SSH Secure Shell 3.2.9.1 (non-commercial version) on i686-pc-linux-gnu<br /><br /><strong>2. Connect and login to remote host:</strong></p><p>The First time when you login to the remotehost from a localhost, it will display the host key not found message and you can give &ldquo;yes&rdquo; to continue. The host key of the remote host will be added under .ssh2/hostkeys directory of your home directory, as shown below.<br /><br />localhost$ ssh -l jit remotehost.example.com<br /><br />jit@remotehost.example.com password:</p><p>remotehost.example.com$</p><p>The Second time when you login to the remote host from the localhost, it will prompt only for the password as the remote host key is already added to the known hosts list of the ssh client.<br /><br />localhost$ ssh -l jit remotehost.example.com<br />jit@remotehost.example.com password: <br />remotehost.example.com$<br /><br />For some reason, if the host key of the remote host is changed after you logged in for the first time, you may get a warning message as shown below. This could be because of various reasons such as 1) Sysadmin upgraded/reinstalled the SSH server on the remote host 2) someone is doing malicious activity etc., The best possible action to take before saying &ldquo;yes&rdquo; to the message below, is to call your sysadmin and identify why you got the host key changed message and verify whether it is the correct host key or not.<br /><br />localhost$ ssh -l jit remotehost.example.com<br /><br />jit @remotehost.example.com's password: <br />remotehost$<br /><br /><strong>4. Debug SSH Client:</strong><br /><br />Sometimes it is necessary to view debug messages to troubleshoot any SSH connection issues. For this purpose, pass -v (lowercase v) option to the ssh as shown below.<br /><br />Example without debug message:<br /><br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; localhost$ ssh -l jit remotehost.example.com<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; warning: Connecting to remotehost.example.com failed: No address associated to the name<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; localhost$</p><p>Example with debug message:<br /><br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; locaclhost$ ssh -v -l jit remotehost.example.com<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; debug: SshConfig/sshconfig.c:2838/ssh2_parse_config_ext: Metaconfig parsing stopped at line 3.<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; debug: SshConfig/sshconfig.c:637/ssh_config_set_param_verbose: Setting variable 'VerboseMode' to 'FALSE'.<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; debug: SshConfig/sshconfig.c:3130/ssh_config_read_file_ext: Read 17 params from config file.<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; debug: Ssh2/ssh2.c:1707/main: User config file not found, using defaults. (Looked for '/home/jit/.ssh2/ssh2_config')<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; debug: Connecting to remotehost.example.com, port 22... (SOCKS not used)<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; warning: Connecting to remotehost.example.com failed: No address associated to</p><p><strong>5. Escape Character: (Toggle SSH session, SSH session statistics etc.)</strong><br /><br />Escape character ~ get&rsquo;s SSH clients attention and the character following the ~ determines the escape command.<br />Toggle SSH Session: When you&rsquo;ve logged on to the remotehost using ssh from the localhost, you may want to come back to the localhost to perform some activity and go back to remote host again. In this case, you don&rsquo;t need to disconnect the ssh session to the remote host. Instead follow the steps below.</p><p>i. Login to remotehost from localhost: localhost$ssh -l jit remotehost<br />ii. Now you are connected to the remotehost: remotehost$<br />iii. To come back to the localhost temporarily, type the escape character ~ and Control-Z. When you type ~ you will not see that immediately on the screen until you press and press enter. So, on the remotehost in a new line enter the following key strokes for the below to work: ~<br /><br />&nbsp;&nbsp;&nbsp; remotehost$ ~^Z<br />&nbsp;&nbsp;&nbsp; [1]+&nbsp; Stopped&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ssh -l jit remotehost<br />&nbsp;&nbsp;&nbsp; localhost$</p><p>iv. Now you are back to the localhost and the ssh remotehost client session runs as a typical unix background job, which you can check as shown below:<br /><br />&nbsp;&nbsp;&nbsp; localhost$ jobs<br />&nbsp;&nbsp;&nbsp; [1]+&nbsp; Stopped&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ssh -l jit remotehost<br /><br />v. You can go back to the remote host ssh without entering the password again by bringing the background ssh remotehost session job to foreground on the localhost<br /><br />&nbsp;&nbsp;&nbsp; localhost$ fg %1<br />&nbsp;&nbsp;&nbsp; ssh -l jit remotehost<br />&nbsp;&nbsp;&nbsp; remotehost$</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41831/merqury-reference-free-quality-and-phasing-assessment-for-genome-assemblies</guid>
	<pubDate>Sat, 06 Jun 2020 05:38:34 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41831/merqury-reference-free-quality-and-phasing-assessment-for-genome-assemblies</link>
	<title><![CDATA[Merqury: reference-free quality and phasing assessment for genome assemblies]]></title>
	<description><![CDATA[<p><span>Often, genome assembly projects have illumina whole genome sequencing reads available for the assembled individual. The k-mer spectrum of this read set can be used for independently evaluating assembly quality without the need of a high quality reference. Merqury provides a set of tools for this purpose.</span></p>
<p><span><a href="https://github.com/marbl/meryl">https://github.com/marbl/meryl</a></span></p><p>Address of the bookmark: <a href="https://github.com/marbl/merqury" rel="nofollow">https://github.com/marbl/merqury</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>