<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30304?offset=1480</link>
	<atom:link href="https://bioinformaticsonline.com/related/30304?offset=1480" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/6300/list-of-bioinformatics-vacancy-jobs-opportunity-websites</guid>
	<pubDate>Tue, 12 Nov 2013 20:04:28 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/6300/list-of-bioinformatics-vacancy-jobs-opportunity-websites</link>
	<title><![CDATA[List of Bioinformatics Vacancy, Jobs, Opportunity websites]]></title>
	<description><![CDATA[<p>Bioinformatics cover wide area of biology, and indulge in almost all sort of science related work. Bioinformatician give strong emphasis on open access to biological information as well as Free and Open Source software!!</p>
<p>There are several jobs opening in bioinformatics all around the world, but many of them do not get proper attention due to lack of advertisements, or social connectivity. This bookmark is created for an academic, non-academic, scientists and budding researchers to help and updates the bioinformatics/computational biology jobs links of all know websites around the world.</p>
<p><strong>I also love to stream the live <strong>bioinformatics or Computational biology jobs</strong> updates using Twitter https://twitter.com/search?q=bioinformatics%20jobs&amp;src=typd</strong></p>
<p>Find out here about exciting job opportunities in the life sciences.</p>
<blockquote>
<p>Please add well known bioinformatics jobs websites below in comment section.</p>
</blockquote><p>Address of the bookmark: <a href="http://www.nature.com/naturejobs/science/jobs?utf8=%E2%9C%93&amp;q=bioinformatics&amp;where=&amp;commit=Find+Jobs" rel="nofollow">http://www.nature.com/naturejobs/science/jobs?utf8=%E2%9C%93&amp;q=bioinformatics&amp;where=&amp;commit=Find+Jobs</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/6561/mathomics-lab</guid>
  <pubDate>Tue, 19 Nov 2013 18:17:32 -0600</pubDate>
  <link></link>
  <title><![CDATA[MATHomics Lab]]></title>
  <description><![CDATA[
<p>Mathomics is a collaborative research group of the Center for Mathematical Modeling and the Center for Genome Regulation at University of Chile, created to play a central role in the development of biotechnological projects, providing state of the art bioinformatics and mathematical modeling tools,  allowing to face these problems from the point of view of Systems Biology. </p>

<p>Lab page @ http://www.mathomics.cl/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6817/research-assistant-university-of-hyderabad</guid>
  <pubDate>Mon, 25 Nov 2013 10:21:26 -0600</pubDate>
  <link></link>
  <title><![CDATA[Research Assistant @ University of Hyderabad]]></title>
  <description><![CDATA[
<p>University of Hyderabad<br />Repository for Tomato Genomic Resources<br />Department of Plant Sciences<br />Bioinformatics Position in Tomato Functional Genomics </p>

<p>At the Repository for Tomato Genomics Resources, we are working on Tomato Functional Genomics, using TILLING, Insertional Mutagenesis, proteomics, metabolomics approaches to study fruit ripening in tomato. The current aims of the group include using reverse and forward genetics strategies to isolate tomato mutants delayed in ripening, having high lycopene and folate content in tomato fruits and analysis of light and hormonal signal transduction pathways. For recent publications of the group see (Plant Physiol 161: 2085–2101, Plant Physiol 156: 1424-1438; Molecular Plant 3: 854-869; Plant Methods 6: 3; Plant Methods 5:18; Plant Signaling and Behavior 5:11.).</p>

<p>Currently we have one position available in the projects awarded to Prof. R.P. Sharma funded by Dept of Biotechnology. The qualification for this Position is as follows:</p>

<p>Research Assistant: Applicants should have experience in networking using R language and should be able to develop networks using the transcriptome, proteome and metabolite data sets. M.Tech. in Bioinformatics is required. The selected candidate would be paid Rs. 13,000/-pm- consolidated.</p>

<p>Candidates interested in above positions should send a one page statement clearly explaining how their skills are relevant to the position. The candidates should also enclose detailed CV and the name/email id for three referees. The candidates can send their application by email at rameshwar.sharma@uohyd.ac.in and y.sreelakshmi@uohyd.ac.in on or before December 10th, 2013. The position is purely temporary in nature. Shortlisted candidates would be called for interview. No TA/DA would be provided for attending the interview. We also have openings for CSIR-NET JRF candidates for pursuing PhD in above research areas.</p>

<p>Interested candidates with CSIR-NET JRF can send their CV to the above email<br />addresses.</p>

<p>Advertisement:</p>

<p>http://www.uohyd.ac.in/images/recruitment/tomanet_positions_221113.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</guid>
	<pubDate>Thu, 14 May 2020 15:09:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</link>
	<title><![CDATA[LR_Gapcloser: a tiling path-based gap closer that uses long reads to complete genome assembly]]></title>
	<description><![CDATA[<p>LR_Gapcloser is a gap closing tool using long reads from studied species. The long reads could be downloaed from public read archive database (for instance, NCBI SRA database ) or be your own data. Then they are fragmented and aligned to scaffolds using BWA mem algorithm in BWA package. In the package, we provided a compiled bwa, so the user needn't to install bwa. LR_Gapcloser uses the alignments to find the bridging that cross the gap, and then fills the long read original sequence into the genomic gaps.</p><p>Address of the bookmark: <a href="https://github.com/CAFS-bioinformatics/LR_Gapcloser" rel="nofollow">https://github.com/CAFS-bioinformatics/LR_Gapcloser</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/7816/boku-lab</guid>
  <pubDate>Wed, 08 Jan 2014 19:33:12 -0600</pubDate>
  <link></link>
  <title><![CDATA[BOKU Lab]]></title>
  <description><![CDATA[
<p>We are interested in the study of complex systems in living organisms. Novel views augmenting the classical gene by gene approaches are required to overcome the engineered redundancies and combinatorial effects prevalent in higher eukaryotes. We therefore combine work to establish improved quantitative experimental assays, such as microarrays or differential in-gel electrophoresis, and development of modern computational methods, such as hierarchical probabilistic models or integration of heterogeneous data sources, focussed by biological studies in our laboratory and collaborations.</p>

<p>Highlights of our research include:</p>

<p>    Optimization of microarray design, probe signal interpretation <br />    Advanced models and tools for expression profiling<br />    State-of-the-art applications and integrated analyses </p>

<p>Lab page @ http://bioinf.boku.ac.at/</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7213/postdoctoral-position-bioinformaticscomputational-biology</guid>
  <pubDate>Thu, 12 Dec 2013 17:58:00 -0600</pubDate>
  <link></link>
  <title><![CDATA[Postdoctoral Position (Bioinformatics/Computational Biology)]]></title>
  <description><![CDATA[
<p>University College Cork<br />LAPTI<br />Cork-Co Cork-Ireland</p>

<p>Postdoctoral position is available for three years to work on development of Bioinformatics resources for the analysis and visualization of ribosome profiling data. Ribosome profiling (ribo-seq) is a technology that allows mapping positions of the ribosomes on the whole transcriptome level with a nucleotide precision. The technology allows obtaining high resolution digital snapshots of gene expression in cells. The position is available starting on the 1st of October, 2013.</p>

<p>Candidate is expected to have Ph.D. in Bioinformatics or Computational Biology. Candidates with the degree in non-Biological disciplines such as Computer Science, Statistics, Applied Mathematics, Physics or Electrical Engineering will also be considered.</p>

<p>The position is available at LAPTI (http://lapti.ucc.ie) that is located in the Western Gate Building (http://www.stwarchitects.com/project-information.php?c=1&amp;p=09993) at University College Cork. Western Gate Building Research Complex hosts several UCC departments and provides ideal environment for interdisciplinary research. Cork (sometimes referenced as “Venice of Ireland”) is the second most populous city in the Republic. It has friendly cosmopolitan atmosphere and vibrant culture. A number of American industrial giants such as Apple , EMC and Pfizer have chosen Cork as a home for their European headquarters.</p>

<p>The details of the application process are given at http://lapti.ucc.ie/jobs.html. To ensure prompt processing of your application use the subject line: ‘Postdoc computational’. All applications received prior to August the 1st are guaranteed equal consideration. However, applications at the later dates will also be considered until the position is filled.</p>

<p>For more info visit http://lapti.ucc.ie</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/7288/critical-to-discoveries-in-bioinformatics</guid>
	<pubDate>Mon, 16 Dec 2013 17:13:24 -0600</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/7288/critical-to-discoveries-in-bioinformatics</link>
	<title><![CDATA[Critical to discoveries in bioinformatics]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/MnKvMP8CeSQ" frameborder="0" allowfullscreen></iframe>EMBL-EBI distributes datasets worldwide using the Janet network. This biological data enables the discovery of new drugs, new diagnostics and increasingly new agro-chemicals.  Their work, which includes the 1000-genome project, has generated petabytes of data and this growth is showing no signs of abating.  On-demand bandwidth over Janet will therefore be critical to their ongoing work.]]></description>
	
</item>

</channel>
</rss>