Address of the bookmark: https://biokit.readthedocs.io/en/latest/index.html

The tutorial is divided in three main parts:

• In the Sequence part, you will see how to look efficiently for a particular protein sequence, how to blast it against the database of your choice to find homologues, how to perform a multiple alignment of the homologues you've selected and how to edit this alignment.
• The Structure part is about molecular visualization, homology modeling and structural domain prediction.
• In the Function part, you will be introduced to you 3 useful servers to investigate the function of a protein. i.e. finding interactors, co-expressed genes, see a phylogenetic profile, easily access papers citing your gene etc ...

During all the three parts, we will use the S. cerevisiae VPS36 protein as an example.

Address of the bookmark: http://www.mrc-lmb.cam.ac.uk/rlw/text/bioinfo_tuto/introduction.html

De Bruijn Graphs for NGS Assembly
Algorithms for PacBio Reads
Software and Hardware Concepts for Bioinformatics
Finding us in Homolog.us (Search Algorithms)
NGS Genome and RNAseq Assembly - a Hands on Primer
Introduction to PERL, Python, R and C/C++ for Bioinformatics

Address of the bookmark: http://www.homolog.us/Tutorials/

For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.

http://milkweedgenome.org/?q=scripts

Address of the bookmark: http://milkweedgenome.org/?q=scripts

If you currently use a spreadsheet like Microsoft Excel for data analysis, you might be interested in taking a look at this tutorial on how to transition from Excel to R by Tony Ojeda. The tutorial explains how to use R functions in place of Excel formulas, including tools like =AVERAGE and =VLOOKUP. For the most part, it uses modern R packages to keep the R code clear and concise.

You'll likely still be using Excel as a data source, though, so you'll also want to check out this guide to importing data from Excel to R from MilanoR.

Reference http://www.r-bloggers.com/an-r-tutorial-for-microsoft-excel-users/

• Function(data, options)

Even quit is a function

• q()

So is help

help(read.table)

Provides the help page for the FUNCTION ‘read.table’

help.search(“t test”)

Searches for help pages that might relate to the phrase ‘t test’

NOTE: quotes are needed for search strings, they are not needed when referring to data objects or function names.

There is a short cut for help,

? shows the help page on a function name, same as help(function)

?read.table

?? searches for help pages on functions, same as help.search(‘phrase’)

??“t test”

Information is usually returned from a function, by default this is printed to screen

read.table(‘data.tsv’)

This can always be stored, we call what it is stored in an ‘object’

mydata

here mydata is an object of type dataframe

Reminder:

• Vector: a list of numbers, equivalent to a column in a table
• Data Frame = a collection of vectors. Equivalent to a table

Hint:

• Up/Down arrow keys can be use to cycle through previous commands

Code in almost all popular languages using Coding Ground. Edit, compile, execute and share your projects, 100% cloud.

http://www.tutorialspoint.com/codingground.htm

Address of the bookmark: http://www.tutorialspoint.com/codingground.htm

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl