<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30355?offset=440</link>
	<atom:link href="https://bioinformaticsonline.com/related/30355?offset=440" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/38642/thank-you-email-after-bioinformatics-interview</guid>
	<pubDate>Tue, 08 Jan 2019 15:37:33 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/38642/thank-you-email-after-bioinformatics-interview</link>
	<title><![CDATA[Thank You Email After Bioinformatics Interview !]]></title>
	<description><![CDATA[<p>A good interview thank you email or note should contain three essential pieces:</p><p>a) Show appreciation for their time and thank them</p><p>b) Mention something specific you talked about in the interview, so they know it&rsquo;s not a cut &amp; paste email</p><p>c) Express interest in the position and tell them you&rsquo;re excited to learn more</p><p>d)&nbsp;Invite them to contact you if they have any questions/concerns, or need clarification on anything discussed</p><p>First sample:</p><blockquote><p>Dear Dr XYZ<br />I enjoyed speaking with you today about the XXX position&nbsp;at the X Lab, Uni. The job seems to be an excellent match for my&nbsp;skills and interests.<br /><br />The lab loaded with new updated technology and international experts,&nbsp;that you informed while interviewing confirmed my desire to work with&nbsp;X lab.<br /><br />In addition to my enthusiasm, I will bring to the position strong&nbsp;writing skills, assertiveness, and the ability to encourage others to&nbsp;work cooperatively with the group<br /><br />I appreciate the time you took to interview me. I am very interested&nbsp;in working with you and look forward to hearing from you regarding&nbsp;this position.<br /><br />Sincerely,<br />XXX</p></blockquote><p>Second sample:</p><p>&nbsp;</p><blockquote><p>Dear Dr XXX,</p><p>I wanted to take a second to thank you for your time . I enjoyed our conversation about and enjoyed learning about the position overall.</p><p>It sounds like an exciting opportunity, and an opportunity I could succeed and excel in! I&rsquo;m looking forward to hearing any updates you can share, and don&rsquo;t hesitate to contact me if you have any questions or concerns in the meantime.</p><p>Thanks again for the great conversation .</p><p>Best Regards,<br />XXX</p></blockquote>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/40228/bioinformatics-services-cro-services</guid>
	<pubDate>Wed, 06 Nov 2019 00:33:11 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/40228/bioinformatics-services-cro-services</link>
	<title><![CDATA[Bioinformatics Services / CRO Services]]></title>
	<description><![CDATA[<p>RASA is set to provide premium technical and scientific services in a form of solutions, product development and training. .We are also very proficient in providing the high quality Research &amp; Development services in life science informatics field like Next Generation Sequencing (NGS) Data Analysis,Computational Drug Discovery, Bioinformatics, Chemo-informatics and BIO-IT.</p><p>RASA offers faster, better and cost effective cutting edge technology solutions to chemical and life science research and industry. We provide our customers with A seamless model of wide expertise and comprehensive platforms. Our Value is to take our customers</p>]]></description>
	<dc:creator>RASA Life Sciences</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34488/scripts-for-the-analysis-of-hgt-in-genome-sequence-data</guid>
	<pubDate>Wed, 29 Nov 2017 16:44:10 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34488/scripts-for-the-analysis-of-hgt-in-genome-sequence-data</link>
	<title><![CDATA[Scripts for the analysis of HGT in genome sequence data.]]></title>
	<description><![CDATA[<p><span>Scripts for the analysis of HGT in genome sequence data</span></p><p>Address of the bookmark: <a href="https://github.com/reubwn/hgt" rel="nofollow">https://github.com/reubwn/hgt</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/40503/3-phd-positions-available-in-the-area-of-bioinformaticscomputational-biology-at-ulsteracuk</guid>
  <pubDate>Thu, 02 Jan 2020 12:41:10 -0600</pubDate>
  <link></link>
  <title><![CDATA[3 PhD positions available in the area of Bioinformatics/Computational Biology at ulster.ac.uk]]></title>
  <description><![CDATA[
<p>3 PhD positions available in the area of Bioinformatics/Computational Biology, Machine Learning (ML)/Artificial Intelligence (AI), Biomarker Discovery, Stratified/Personalized Medicine in Mental Health, Diabetes and Multimorbidity. Please see details (weblinks) below:</p>

<p>1. https://www.ulster.ac.uk/doctoralcollege/find-a-phd/510894<br />2. https://www.ulster.ac.uk/doctoralcollege/find-a-phd/511458<br />3. https://www.ulster.ac.uk/doctoralcollege/find-a-phd/512618</p>

<p>Looking for students with good computational/programming skills (preferable in Linux/Shell, Python and/or R) and knowledge in computational biology and statistics. However, students from more biology oriented background but strong interest to learn bioinformatics and programming are also encouraged to apply.</p>

<p>Informal inquiries are welcomed at: p.shukla@ulster.ac.uk</p>

<p>Dr Priyank Shukla PhD FHEA FCHERP<br />Lecturer (Asst Prof) in Stratified Medicine (Bioinformatics)</p>

<p>Northern Ireland Centre for Stratified Medicine<br />Biomedical Sciences Research Institute<br />University of Ulster (Magee Campus)<br />C-TRIC Building, Altnagelvin Area Hospital<br />Glenshane Road, Derry/Londonderry<br />BT47 6SB, Northern Ireland, United Kingdom</p>

<p>T: +44 28 7167 5690<br />E: p.shukla@ulster.ac.uk<br />W: https://www.ulster.ac.uk/staff/p-shukla</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35131/giggle-a-search-engine-for-large-scale-integrated-genome-analysis</guid>
	<pubDate>Wed, 10 Jan 2018 03:10:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35131/giggle-a-search-engine-for-large-scale-integrated-genome-analysis</link>
	<title><![CDATA[GIGGLE: a search engine for large-scale integrated genome analysis]]></title>
	<description><![CDATA[<p><span>GIGGLE is a genomics search engine that identifies and ranks the significance of genomic loci shared between query features and thousands of genome interval files. GIGGLE (</span><a href="https://github.com/ryanlayer/giggle">https://github.com/ryanlayer/giggle</a><span>) scales to billions of intervals and is over three orders of magnitude faster than existing methods. Its speed extends the accessibility and utility of resources such as ENCODE, Roadmap Epigenomics, and GTEx by facilitating data integration and hypothesis generation.</span></p>
<p>https://www.nature.com/articles/nmeth.4556</p><p>Address of the bookmark: <a href="https://github.com/ryanlayer/giggle" rel="nofollow">https://github.com/ryanlayer/giggle</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/42263/data-steward-research-development-specialist-at-at-the-luxembourg-centre-for-systems-biomedicine-lcsb</guid>
  <pubDate>Sun, 25 Oct 2020 22:36:38 -0500</pubDate>
  <link></link>
  <title><![CDATA[Data Steward / Research &amp; Development Specialist at at the Luxembourg Centre for Systems Biomedicine (LCSB)]]></title>
  <description><![CDATA[
<p>Applications should be addressed online to: Prof. Dr. Reinhard Schneider, Head of the Bioinformatics Core Facility</p>

<p>For further information, please contact: Dr. Pinar Alper (pinar.alper@uni.lu)</p>

<p>Applications should be submitted online and include:</p>

<p>A detailed curriculum vitae<br />Cover letter mentioning the reference number<br />List of publications/software projects<br />Description of past experience and future interests<br />Names and addresses of three referees<br />Early application is highly encouraged, as the applications will be processed upon reception. Please apply ONLINE formally through the HR system. Applications by email will not be considered.</p>

<p>*gn=gender neutral.</p>

<p>More at https://recruitment.uni.lu/en/details.html?nPostingId=54616&amp;nPostingTargetId=74219&amp;id=QMUFK026203F3VBQB7V7VV4S8&amp;LG=UK&amp;mask=karriereseiten&amp;sType=Social%20Recruiting</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35920/mesquite-a-modular-system-for-evolutionary-analysis</guid>
	<pubDate>Tue, 13 Mar 2018 06:54:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35920/mesquite-a-modular-system-for-evolutionary-analysis</link>
	<title><![CDATA[Mesquite: A modular system for evolutionary analysis]]></title>
	<description><![CDATA[<p><span>Mesquite is modular, extendible software for evolutionary biology, designed to help biologists organize and analyze comparative data about organisms. Its emphasis is on phylogenetic analysis, but some of its modules concern population genetics, while others do non-phylogenetic multivariate analysis. Because it is modular, the analyses available depend on the modules installed.</span></p>
<p><span>https://github.com/MesquiteProject/MesquiteCore</span></p><p>Address of the bookmark: <a href="http://mesquiteproject.org/" rel="nofollow">http://mesquiteproject.org/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/42164/postdoctoral-researcher-in-statistical-bioinformatics-at-orebro-university</guid>
  <pubDate>Wed, 26 Aug 2020 10:20:11 -0500</pubDate>
  <link></link>
  <title><![CDATA[Postdoctoral Researcher in Statistical Bioinformatics at Örebro University]]></title>
  <description><![CDATA[
<p>The position is in Medical Sciences, with special focus on Statistical Bioinformatics.</p>

<p>The position is a full-time position for a fixed term of two years. The salary depends on the successful candidate’s qualifications and experience.</p>

<p>For more information, please contact Prof. Dirk Repsilber,This is an email address, Prof. Hugo Hesser, This is an email addressor Prof. Allan Sirsjö, allan.This is an email address, or Prof. Robert Brummer,This is an email address.</p>

<p>Örebro University actively pursues an equal work environment and values the qualities that diversity adds to our operations.</p>

<p>More detail at https://www.oru.se/english/working-at-orebro-university/jobs-and-vacancies/job/?jid=20200286/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39441/snakepipes-a-toolkit-based-on-snakemake-and-python-for-analysis-of-ngs-data</guid>
	<pubDate>Thu, 30 May 2019 04:06:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39441/snakepipes-a-toolkit-based-on-snakemake-and-python-for-analysis-of-ngs-data</link>
	<title><![CDATA[snakepipes: A toolkit based on snakemake and python for analysis of NGS data]]></title>
	<description><![CDATA[<p><span><span>snakePipes are flexible and powerful workflows built using&nbsp;</span><a href="https://github.com/maxplanck-ie/snakepipes/blob/master/snakemake.readthedocs.io">snakemake</a><span>&nbsp;that simplify the analysis of NGS data.</span></span></p>
<ul>
<li>DNA-mapping*</li>
<li>ChIP-seq*</li>
<li>RNA-seq*</li>
<li>ATAC-seq*</li>
<li>scRNA-seq</li>
<li>Hi-C</li>
<li>Whole Genome Bisulfite Seq/WGBS</li>
</ul>
<p><span>(*Also available in "allele-specific" mode)</span></p>
<p><span>snakePipes can be installed via conda : </span></p>
<p><span>'conda install -c mpi-ie -c bioconda -c conda-forge snakePipes'. </span></p>
<p><span>Source code (</span><a href="https://github.com/maxplanck-ie/snakepipes" target="">https://github.com/maxplanck-ie/snakepipes</a><span>) and documentation (</span><a href="https://snakepipes.readthedocs.io/en/latest/" target="">https://snakepipes.readthedocs.io/en/latest/</a><span>) are available online.</span></p><p>Address of the bookmark: <a href="https://github.com/maxplanck-ie/snakepipes" rel="nofollow">https://github.com/maxplanck-ie/snakepipes</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>