• In a GitHub or GitLab repository
• Free to use
• Written in markdown or similar

NOTE: This list of courses is selected only based on the above criteria.
There are no checks on quality.

https://glittr.org/?per_page=25&sort_by=stargazers&sort_direction=desc

Address of the bookmark: https://glittr.org/?per_page=25&sort_by=stargazers&sort_direction=desc

#Find all occurrences of a pattern in a string.
#Given: Strings Pattern and Genome.
#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.

use strict;
use warnings;

my $string="GATATATGCATATACTT";
my $subStr="ATAT";
my $kmer=length($subStr);

kmerMatch ($string, $subStr, $kmer);

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
for (my $aa=0; $aa<=(length($string)-$kmer); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        print $aa;
    }
}
}

Essential Qualifications: Ph.D. (Bioinformatics/ Biophysics/ Biotechnology or any other stream of biological/ physical sciences) with a minimum of two publications in reputed peer reviewed journals in the area of structural bioinformatics or biophysics or biomolecular modeling/ simulation.

Job description: Development of bioinformatics tools and algorithms/software for structure based analysis of biomolecular systems. Programmatic access to major biomolecular databases using APIs Knowledge based prediction and analysis of biomolecular structure, function and interactions. Docking/simulations for inhibitor design.

Desirable Qualifications (Research Associate/s): i) Strong computer programming skills (in Python/PERL/PHP or C++ or object oriented database management systems like MySQL etc or scripting languages under LINUX/UNIX environment).

ii) Extensive experience in computational analysis of biomolecular structure/interactions and usage of advanced biomolecular simulation softwares. iii) Adequate knowledge of major databases, webservers and softwares in the area of biomolecular structure/function and drug design. iv) Familiarity with Parallel Programming environments and experience in usage of high-end HPC clusters.

The candidates must highlight their experience in above mentioned fields/topics in their CV. Initial appointment will be for a period of 1 year, subject to extension after review of performance.

Emoluments: As per DST, GOI norms and commensurate with experience.

More at https://www.iisc.ac.in/positions-open/

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

More at https://leidosbiomed.csod.com/ats/careersite/jobdetails.aspx?site=4&c=leidosbiomed&id=2040

The tutorial is divided in three main parts:

• In the Sequence part, you will see how to look efficiently for a particular protein sequence, how to blast it against the database of your choice to find homologues, how to perform a multiple alignment of the homologues you've selected and how to edit this alignment.
• The Structure part is about molecular visualization, homology modeling and structural domain prediction.
• In the Function part, you will be introduced to you 3 useful servers to investigate the function of a protein. i.e. finding interactors, co-expressed genes, see a phylogenetic profile, easily access papers citing your gene etc ...

During all the three parts, we will use the S. cerevisiae VPS36 protein as an example.

Address of the bookmark: http://www.mrc-lmb.cam.ac.uk/rlw/text/bioinfo_tuto/introduction.html

More at http://www.bx.psu.edu/~rsharris/lastz/

Thesis: http://www.bx.psu.edu/~rsharris/rsharris_phd_thesis_2007.pdf

Address of the bookmark: http://www.bx.psu.edu/~rsharris/lastz/

Position 1: Traineeship
Monthly fellowship (in rupee): 5,000/-
No. of vacancies: Two
Required Qualification: First Class M.Sc Bioinformatics/ Biotechnology/ Botany

Position 2: Studentship
Monthly fellowship (in rupee): 5,000/-
No. of vacancies: Two
Required Qualification: M.Phil/M.Tech Bioinformatics/ Biotechnology/ any branch of Life Science students for doing their thesis work in the area of Bioinformatics.

Age limit as on 1.1.2015, 28 years. Age relaxation will be provided for SC, ST, OBC candidates as per Govt. norms.

Interested candidates may appear for walk-in-interview on 15th May 2015 at 10.30 am at JNTBGRI, Palode, Thiruvananthapuram. The candidate should report to the Office at Palode before 10.00 am.

More at http://jntbgri.res.in/news/appointment-of-two-traineeships-and-two-studentships-in-bioinformatics/

More at http://www.bioinsilico.org/