BOL: Related items

Apollo: a sequence annotation editor

Abhimanyu Singh — Tue, 27 Aug 2019 08:08:47 -0500

The well-established inaccuracy of purely computational methods for annotating genome sequences necessitates an interactive tool to allow biological experts to refine these approximations by viewing and independently evaluating the data supporting each annotation. Apollo was developed to meet this need, enabling curators to inspect genome annotations closely and edit them

Address of the bookmark: https://genomebiology.biomedcentral.com/articles/10.1186/gb-2002-3-12-research0082

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

GfaViz: flexible and interactive visualization of GFA sequence graphs

Jit — Thu, 23 Jan 2020 07:33:46 -0600

GFA (Graphical Fragment Assembly) is an emerging standard format for representing sequence graphs. Although it was originally conceived as a format for sequence assembly (hence the name), and this remains its core application, it is more general, and able to represent many different types of sequence graphs, including scaffolding graphs, alignment graphs, variant graphs and splicing graphs.

Address of the bookmark: https://github.com/ggonnella/gfaviz

flexidot: Highly customizable, ambiguity-aware dotplots for visual sequence analyses

Jit — Fri, 24 Apr 2020 08:39:28 -0500

FlexiDot is a cross-platform dotplot suite generating high quality self, pairwise and all-against-all visualizations. To improve dotplot suitability for comparison of consensus and error-prone sequences, FlexiDot harbors routines for strict and relaxed handling of mismatches and ambiguous residues. The custom shading modules facilitate dotplot interpretation and motif identification by adding information on sequence annotations and sequence similarities to the images. Combined with collage-like outputs, FlexiDot supports simultaneous visual screening of a large sequence sets, allowing dotplot use for routine screening.

Address of the bookmark: https://github.com/molbio-dresden/flexidot

Rosenberg lab

Wed, 27 May 2015 17:52:24 -0500

Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

UniAligner: a parameter-free framework for fast sequence alignment

Abhi — Fri, 08 Mar 2024 23:36:12 -0600

UniAligner (formerly, TandemAligner) is the first parameter-free algorithm for sequence alignment that introduces a sequence-dependent alignment scoring that automatically changes for any pair of compared sequences. Classical alignment approaches, such as the Smith-Waterman algorithm, that work well for most sequences, fail to construct biologically adequate alignments of extra-long tandem repeats (ETRs), such as human centromeres and immunoglobulin loci. This limitation was overlooked in the previous studies since the sequences of the centromeres and other ETRs across multiple genomes only became available recently.

More at https://www.nature.com/articles/s41592-023-01970-4

Address of the bookmark: https://github.com/seryrzu/unialigner

JRF Bioinformatics @ ICAR - National Research Centre for Orchids Pakyong

Thu, 28 May 2015 19:33:19 -0500

ICAR - National Research Centre for Orchids

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Clump Finding Problem Solved with Perl

Jit — Wed, 10 Jun 2015 00:17:17 -0500

The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

RA at University of Delhi

Wed, 17 Jun 2015 20:35:35 -0500

Research Scientist Jobs opportunity in University of Delhi on temporary basis

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83