<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30440?offset=1190</link>
	<atom:link href="https://bioinformaticsonline.com/related/30440?offset=1190" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/9666/phylogenomicsphylogenetic-website</guid>
	<pubDate>Mon, 07 Apr 2014 02:17:18 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/9666/phylogenomicsphylogenetic-website</link>
	<title><![CDATA[Phylogenomics/Phylogenetic website]]></title>
	<description><![CDATA[<div>
<p>Welcome to phylobabble.org, a discussion forum for phylogenetic theory and applications. The primary goal of this forum is to discuss best practice and new developments in phylogenetics. Although we do have a Troubleshooting category for getting feedback on analyses, this is not a help site for running phylogenetics programs.</p>
<p>A great place to chat about phylogenetics for researchers and the broader community of students and science-interested citizens. </p>
</div><p>Address of the bookmark: <a href="http://phylobabble.org/" rel="nofollow">http://phylobabble.org/</a></p>]]></description>
	<dc:creator>Aaryan Lokwani</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</guid>
	<pubDate>Wed, 07 Feb 2018 10:44:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</link>
	<title><![CDATA[GenomeTools: The versatile open source genome analysis software]]></title>
	<description><![CDATA[<p>The&nbsp;<em>GenomeTools</em>&nbsp;genome analysis system is a&nbsp;<a href="http://genometools.org/license.html">free</a>&nbsp;collection of bioinformatics&nbsp;<a href="http://genometools.org/tools.html">tools</a>&nbsp;(in the realm of genome informatics) combined into a single binary named&nbsp;<em>gt</em>. It is based on a C library named &ldquo;libgenometools&rdquo; which consists of several modules.</p>
<p>If you are interested in gene prediction, have a look at&nbsp;<a href="http://genomethreader.org/" title="GenomeThreader gene prediction        software"><em>GenomeThreader</em></a>.</p><p>Address of the bookmark: <a href="http://genometools.org/" rel="nofollow">http://genometools.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/14191/scalpel</guid>
	<pubDate>Wed, 20 Aug 2014 02:07:58 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/14191/scalpel</link>
	<title><![CDATA[Scalpel]]></title>
	<description><![CDATA[<p>A team from Cold Spring Harbor Laboratory has released an algorithm, called Scalpel, for finding insertions and deletions in next generation sequencing data sets. Scalpel, which is open source and <a href="http://scalpel.sourceforge.net/" title="available for download">available for download</a> on SourceForge,&nbsp;<span>outperformed the popular tools GATK HaplotypeCaller and SOAPindel in test runs on both simulated and real whole human exomes.</span></p><p>Like other indel callers, Scalpel works by performing <em>de novo</em>&nbsp;assembly of regions of interest, so that misalignment to the reference genome cannot obscure the presence of an insertion or deletion. Scalpel's innovation is to repeatedly check its assembly before comparing to the reference genome, to account for simple sequence repeats that are a regular source of error in indel calling. When Scalpel assembles an exon, it collects reads that map to that exon (including partial matches), splits them into k-mers, and creates a de Bruijn graph to span the exon; however, if it detects repeats in the map, it iteratively increases the size of the k-mers by one base until the repeats are eliminated. This ensures that the final assembly of the exon is highly accurate while minimizing compute time.</p><p>The Cold Spring Harbor team's validation of Scalpel, <a href="http://www.nature.com/nmeth/journal/vaop/ncurrent/full/nmeth.3069.html" title="published over the weekend in Nature Methods">published over the weekend in <em>Nature Methods</em></a>, compares Scalpel's performance on a live whole exome against HaplotypeCaller and SOAPindel. The donor is an individual with serious neurological disorders, which may be linked to a high incidence of indels. One thousand indels from this individual's exome, called by one or more of the informatics pipelines, were selected for focused resequencing. This resequencing revealed a 77% true positive rate for Scalpel calls, dramatically better than the rates for either of the competing tools; Scalpel performed especially well with indels longer than five base pairs, a traditional weak point for indel callers.</p><p>Finally, the authors demonstrate Scalpel's use on a large set of genetic data from nearly 600 families who donated samples to the Simons Simplex Collection, a project of the Simons Foundation Autism Research Initiative. Scalpel found a very high enrichment for indels in children affected by autism, compared with their unaffected siblings, a pattern that persisted even after excluding common variants.</p>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</guid>
	<pubDate>Tue, 08 May 2018 04:52:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</link>
	<title><![CDATA[Metassembler: merging and optimizing de novo genome assemblies]]></title>
	<description><![CDATA[<p><span>Metassembler combines multiple whole genome de novo assemblies into a combined consensus assembly using the best segments of the individual assemblies.</span></p>
<p><span><span>Genome assembly projects typically run multiple algorithms in an attempt to find the single best assembly, although those assemblies often have complementary, if untapped, strengths and weaknesses. We present our metassembler algorithm that merges multiple assemblies of a genome into a single superior sequence.&nbsp;</span></span></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/metassembler/?source=directory" rel="nofollow">https://sourceforge.net/projects/metassembler/?source=directory</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/10182/biocodesbioscripts</guid>
	<pubDate>Tue, 22 Apr 2014 20:53:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/10182/biocodesbioscripts</link>
	<title><![CDATA[BioCodes/BioScripts]]></title>
	<description><![CDATA[<p>Over the years most bioinformatics people amass a collection of small utility scripts which make their lives easier. Too often they are kept either in private repositories or as part of a public collection to which noone else can contribute. Biocode is a curated repository of general-use utility scripts.</p>
<p>Algorithms scripts @ https://github.com/jschendel/bioinformatics-algorithms-coursera</p><p>Address of the bookmark: <a href="https://github.com/jorvis/biocode" rel="nofollow">https://github.com/jorvis/biocode</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/10380/ra-at-alagappa-university</guid>
  <pubDate>Sun, 04 May 2014 23:33:15 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA at ALAGAPPA UNIVERSITY]]></title>
  <description><![CDATA[
<p>DEPARTMENT OF BIOTECHNOLOGY<br />(UGC SAP and DST-FIST &amp; PURSE Sponsored Department)<br />ALAGAPPA UNIVERSITY<br />(A State University Accredited by NAAC with „A‟ Grade)<br />Karaikudi - 630 004, India</p>

<p>WALK IN INTERVIEW</p>

<p>A walk-in Interview for the following position tenable at the Bioinformatics Infrastructure Facility (BIF), Department of Biotechnology, Alagappa University will be held at the Department of Biotechnology, Alagappa University, Karaikudi 630 003 on 15.05.2014 (Thursday) at 01:00 PM. This national facility is funded by the Department of Biotechnology, Ministry of Science and Technology, Government of India, New Delhi. The main objectives of the Centre involve teaching and research activities in bioinformatics/biotechnology.</p>

<p>RA (One Post):</p>

<p>Salary : Rs. 11000 p.m. plus admissible HRA</p>

<p>Qualification: M.Sc., in Bioinformatics/Biotechnology/Biophysics/Biochemistry/ Life Sciences</p>

<p>Interested candidates are encouraged to send their Curriculum Vitae by email to “sk_pandian@rediffmail.com” in advance. On the day of interview, the candidates must produce original certificates in proof of their educational qualification and experience and a recommendation letter from the Head of the Department/Institution where last studied/worked. Candidates who have already passed the required Degree alone are eligible to appear for interview. No TA&amp;DA will be given for attending the interview.</p>

<p>Advertisement: http://www.alagappabiotech.org/Walk%20in%20interview.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/10459/associate-professor-bio-informatics-at-university-of-allahabad-in-allahabad</guid>
  <pubDate>Wed, 07 May 2014 00:26:53 -0500</pubDate>
  <link></link>
  <title><![CDATA[Associate Professor - Bio-Informatics at University of Allahabad in Allahabad]]></title>
  <description><![CDATA[
<p>No of vacancies: 01</p>

<p>Pay scale: Pay Band of Rs. 37400-67000 with AGP of Rs. 9000.</p>

<p>i. Educational Qualification: Good academic record with a Ph.D. Degree in the concerned/allied/relevant disciplines.</p>

<p>ii. A Master's Degree with at least 55% marks (or an equivalent grade in a point scale wherever grading system is followed).</p>

<p>iii. A minimum of eight years of experience of teaching and/or research in an academic/research position equivalent to that of Assistant Professor in a University, College or Accredited Research Institution/industry excluding the period of Ph.D. research with evidence of published work and a minimum of 5 publications as books and/or research/policy papers.</p>

<p>iv. Contribution to educational innovation, design of new curricula and courses, and technology - mediated teaching learning process with evidence of having guided doctoral candidates and research students.</p>

<p>v. A minimum score as stipulated in the Academic Performance Indicator (API) based Performance Based Appraisal System (PBAS), set out in UGC Regulation.</p>

<p>Download application form from website: http://www.allduniv.ac.in/</p>

<p>Send your application to the Registrar, University of Allahabad, Allahabad-211002 (U.P.) on or before 30th April 2014</p>

<p>For more details: http://www.allduniv.ac.in/images/adv/backlog/advt-details.pdf OR http://www.allduniv.ac.in/images/news/extension-notice.pdf</p>

<p>Last Apply Date: 30 May 2014</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</guid>
	<pubDate>Thu, 25 Oct 2018 09:38:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</link>
	<title><![CDATA[Scribl : HTML5 canvas genomics graphic library]]></title>
	<description><![CDATA[<p>Scribl is a javascript, Canvas-based graphics library that easily generates biological visuals of genomic regions, alignments, and assembly data. Scribl can also be used in conventional offline pipelines, since everything needed to generate charts can be contained in a single html file.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://chmille4.github.io/Scribl/" rel="nofollow">http://chmille4.github.io/Scribl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>