<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30550?offset=1170</link>
	<atom:link href="https://bioinformaticsonline.com/related/30550?offset=1170" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35418/karyoploter-plot-whole-genomes-with-arbitrary-data</guid>
	<pubDate>Fri, 02 Feb 2018 03:24:28 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35418/karyoploter-plot-whole-genomes-with-arbitrary-data</link>
	<title><![CDATA[karyoploteR: plot whole genomes with arbitrary data]]></title>
	<description><![CDATA[<p><span><a href="http://bioconductor.org/packages/karyoploteR">karyoploteR</a></span><span>&nbsp;is an R package to create karyoplots, that is, representations of whole genomes with arbitrary data plotted on them. It is inspired by the R base graphics system and does not depend on other graphics packages. The aim of karyoploteR is to offer the user an easy way to plot data along the genome to get broad genome-wide view to facilitate the identification of genome wide relations and distributions.</span></p><p>Address of the bookmark: <a href="https://bernatgel.github.io/karyoploter_tutorial/" rel="nofollow">https://bernatgel.github.io/karyoploter_tutorial/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40937/shinycircos-an-rshiny-application-for-interactive-creation-of-circos-plot</guid>
	<pubDate>Fri, 07 Feb 2020 03:26:58 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40937/shinycircos-an-rshiny-application-for-interactive-creation-of-circos-plot</link>
	<title><![CDATA[shinyCircos: an R/Shiny application for interactive creation of Circos plot]]></title>
	<description><![CDATA[<p><span>shinyCircos, a graphical user interface for interactive creation of Circos plot. shinyCircos can be easily installed either on computers for personal use or on local or public servers to provide online use to the community. Furthermore, various types of Circos plots could be easily generated and decorated with simple mouse-click.</span></p>
<p>Tutorial&nbsp;<a href="http://shinycircos.ncpgr.cn/shinyCircos_Help_Manual.pdf">http://shinycircos.ncpgr.cn/shinyCircos_Help_Manual.pdf</a></p>
<p>Github&nbsp;<a href="https://github.com/venyao/shinyCircos">https://github.com/venyao/shinyCircos</a></p><p>Address of the bookmark: <a href="http://150.109.59.144:3838/shinyCircos/" rel="nofollow">http://150.109.59.144:3838/shinyCircos/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22403/ryan-e-mills-lab</guid>
  <pubDate>Tue, 26 May 2015 09:29:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Ryan E. Mills Lab]]></title>
  <description><![CDATA[
<p>Our research group is primarily focused on the analysis of whole genome sequence data to identify genetic variation (primarily structural variation) and examine their potential functional impact in disease phenotypes. We are particularly interested in analyzing complex regions of the genome that are not easily resolved through modern sequencing approaches and which may exhibit interesting mechanistic origins.</p>

<p>We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics. </p>

<p>More at http://millslab.ccmb.med.umich.edu/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44182/collection-of-graph-visualization-tools</guid>
	<pubDate>Wed, 25 Jan 2023 02:57:42 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44182/collection-of-graph-visualization-tools</link>
	<title><![CDATA[Collection of Graph Visualization tools !]]></title>
	<description><![CDATA[<p>Standard approaches to genome inference and analysis relate sequences to a single linear reference genome. This is efficient but has a fundamental problem: Differences from this reference are hard to observe and describe in a coherent way. Variation and sequence are separated.</p>
<p><a href="https://pangenome.github.io/images/genomic-vs-pangenomic-analysis.png"><img src="https://pangenome.github.io/images/genomic-vs-pangenomic-analysis.png" alt="image" width="45%" style="border: 0px; border: 0px;"></a><span>&nbsp;</span><a href="https://pangenome.github.io/images/genomic-vs-pangenomic-models.png"><img src="https://pangenome.github.io/images/genomic-vs-pangenomic-models.png" alt="image" width="54%" style="border: 0px; border: 0px;"></a></p>
<p><a href="https://fungidb.org/fungidb/app/downloads/Current_Release/GultimumBR650/" target="_blank">https://fungidb.org/fungidb/app/downloads/Current_Release/GultimumBR650/</a></p><p>Address of the bookmark: <a href="https://pangenome.github.io/" rel="nofollow">https://pangenome.github.io/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22416/rosenberg-lab</guid>
  <pubDate>Wed, 27 May 2015 17:52:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Rosenberg lab]]></title>
  <description><![CDATA[
<p>Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:</p>

<p>    Human genetic variation<br />    Inference of human evolutionary history from genetic markers<br />    Statistical analysis of population-genetic data<br />    Mathematical models of gene genealogies<br />    Theoretical population genetics<br />    Combinatorics of evolutionary trees<br />    The relationship between gene trees and species trees<br />    The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility <br />More at https://web.stanford.edu/group/rosenberglab/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/32855/maf2synteny</guid>
	<pubDate>Thu, 18 May 2017 05:31:30 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/32855/maf2synteny</link>
	<title><![CDATA[maf2synteny]]></title>
	<description><![CDATA[<p>A tool for converting for recovering synteny blocks from multiple alignment (in MAF fromat)</p>
<p>This tool is a standalone version of Ragout module [<a href="http://fenderglass.github./Ragout">http://fenderglass.github./Ragout</a>]</p><p>Address of the bookmark: <a href="https://github.com/fenderglass/maf2synteny" rel="nofollow">https://github.com/fenderglass/maf2synteny</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22437/jrf-bioinformatics-icar-national-research-centre-for-orchids-pakyong</guid>
  <pubDate>Thu, 28 May 2015 19:33:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF Bioinformatics @ ICAR - National Research Centre for Orchids  Pakyong]]></title>
  <description><![CDATA[
<p>ICAR - National Research Centre for Orchids</p>

<p>Pakyong</p>

<p>F.No:NRCO/Admn/DBT /136 /</p>

<p>Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.</p>

<p>‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”</p>

<p>Junior Research Fellow (One post)</p>

<p>Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.</p>

<p>Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques</p>

<p>2nd June 2015</p>

<p>Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41694/mercator-multiple-whole-genome-orthology-map-construction</guid>
	<pubDate>Tue, 19 May 2020 16:46:22 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41694/mercator-multiple-whole-genome-orthology-map-construction</link>
	<title><![CDATA[Mercator: Multiple Whole-Genome Orthology Map Construction]]></title>
	<description><![CDATA[<p><span>Whole-genome homology maps attempt to identify the evolutionary relationships between and within multiple genomes. The term "syntenic" is often used to describe regions of multiple genomes that are believed to have evolved from the same region in an ancestral genome. However, it has been pointed out that this use of the term is incorrect (</span><a href="https://www.biostat.wisc.edu/~cdewey/mercator/#refSynteny">Passarge et al. 1999</a><span>) and thus we will use the terms "homologous", "orthologous", and "paralogous" instead. Ideally, given K genomes, we would like to identify all orthologous genomic regions as well as paralogous regions within each genome and hypothetical ancestral genome. Maps listing these relationships are extremely valuable to researchers performing comparative analyses of genomic sequence. Here we present our initial work in the form a program called&nbsp;</span><em>Mercator</em><span>&nbsp;that constructs orthology maps between multiple whole genomes.</span></p><p>Address of the bookmark: <a href="https://www.biostat.wisc.edu/~cdewey/mercator/" rel="nofollow">https://www.biostat.wisc.edu/~cdewey/mercator/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>