BOL: Related items

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Clump Finding Problem Solved with Perl

Jit — Wed, 10 Jun 2015 00:17:17 -0500

The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Scientist - Computational Genomics (Two Positions)

Sat, 12 Mar 2016 18:07:56 -0600

ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these being the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture.

ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.

Responsibilities:Design efficient SQL queries for pulling large sequencing projects.
Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.
Develop and oversee a rapid and incremental software development and release schedule.
Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.
Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.
Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.
Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.
Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.
Assist in training of breeders in the CGIAR centers to use software developed.
Personal Profile:

The applicant should have:

Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL
High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.
She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.
Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.
Ability to mentor colleagues in quality software development practices is desired.
Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.

More at http://www.icrisat.org/careers/

bipype

Jit — Thu, 01 Dec 2016 08:47:38 -0600

Bipype is a very useful program, which prepare a lot of types of bioinformatics analyses. There are three input options: amplicons, WGS (whole genome sequences) and metatranscriptomic data. If amplicons are input data, then bipype does reconstruction and pairs merging. After that biodiversity is searching. There are two types of searching depending on the amplicons types (ITS or 16S). If WGS are chosen, then bipype finds the SA coordinates of the input reads and generates alignments in the SAM format given single-end reads, aligns reads to reference sequence(s). All of these analyses will be shown with Krona program, which allows to show hierarchical data with pie charts.

Address of the bookmark: https://readthedocs.org/projects/bipype/

Bioinformatics 101 - Running BLAST

Tue, 03 Sep 2013 14:59:50 -0500

How to format the database for BLAST, run the command, view the output file, and use BioPerl and Perl to parse the output. By David Francis, Ohio State University. Delivered live at the Tomato Disease Workshop 2010. For more information, please visit http://www.extension.org/pages/32521/bioinformatics-101-video.

Research Associate Bioinformatics in IISc Recruitment 2020

Tue, 23 Jun 2020 21:53:34 -0500

Research Associate Bioinformatics in IISc Recruitment 2020

Essential Qualifications: Ph.D. (Bioinformatics/ Biophysics/ Biotechnology or any other stream of biological/ physical sciences) with a minimum of two publications in reputed peer reviewed journals in the area of structural bioinformatics or biophysics or biomolecular modeling/ simulation.

Job description: Development of bioinformatics tools and algorithms/software for structure based analysis of biomolecular systems. Programmatic access to major biomolecular databases using APIs Knowledge based prediction and analysis of biomolecular structure, function and interactions. Docking/simulations for inhibitor design.

Desirable Qualifications (Research Associate/s): i) Strong computer programming skills (in Python/PERL/PHP or C++ or object oriented database management systems like MySQL etc or scripting languages under LINUX/UNIX environment).

ii) Extensive experience in computational analysis of biomolecular structure/interactions and usage of advanced biomolecular simulation softwares. iii) Adequate knowledge of major databases, webservers and softwares in the area of biomolecular structure/function and drug design. iv) Familiarity with Parallel Programming environments and experience in usage of high-end HPC clusters.

The candidates must highlight their experience in above mentioned fields/topics in their CV. Initial appointment will be for a period of 1 year, subject to extension after review of performance.

Emoluments: As per DST, GOI norms and commensurate with experience.

More at https://www.iisc.ac.in/positions-open/

mojolicious: a next generation web framework for the Perl programming language.

Jit — Fri, 12 Jan 2018 16:48:10 -0600

Back in the early days of the web, many people learned Perl because of a wonderful Perl library called CGI. It was simple enough to get started without knowing much about the language and powerful enough to keep you going, learning by doing was much fun. While most of the techniques used are outdated now, the idea behind it is not. Mojolicious is a new endeavor to implement this idea using bleeding edge technologies.

Features

An amazing real-time web framework, allowing you to easily grow single file prototypes into well-structured MVC web applications.
- Powerful out of the box with RESTful routes, plugins, commands, Perl-ish templates, content negotiation, session management, form validation, testing framework, static file server, CGI/PSGI detection, first class Unicode support and much more for you to discover.
A powerful web development toolkit, that you can use for all kinds of applications, independently of the web framework.
- Full stack HTTP and WebSocket client/server implementation with IPv6, TLS, SNI, IDNA, HTTP/SOCKS5 proxy, UNIX domain socket, Comet (long polling), Promises/A+, keep-alive, connection pooling, timeout, cookie, multipart and gzip compression support.
- Built-in non-blocking I/O web server, supporting multiple event loops as well as optional pre-forking and hot deployment, perfect for building highly scalable web services.
- JSON and HTML/XML parser with CSS selector support.
Very clean, portable and object-oriented pure-Perl API with no hidden magic and no requirements besides Perl 5.24.0 (versions as old as 5.10.1 can be used too, but may require additional CPAN modules to be installed)
Fresh code based upon years of experience developing Catalyst, free and open source.
Hundreds of 3rd party extensions and high quality spin-off projects like the Minion job queue.

http://mojolicious.org/

Address of the bookmark: http://mojolicious.org/

VCFtools: perform common tasks with VCF files such as file validation, file merging, intersecting, complements

Rahul Nayak — Tue, 07 Aug 2018 10:01:46 -0500

VCFtools contains a Perl API (Vcf.pm) and a number of Perl scripts that can be used to perform common tasks with VCF files such as file validation, file merging, intersecting, complements, etc. The Perl tools support all versions of the VCF specification (3.2, 3.3, 4.0, 4.1 and 4.2), nevertheless, the users are encouraged to use the latest versions VCFv4.1 or VCFv4.2. The VCFtools in general have been used mainly with diploid data, but the Perl tools aim to support polyploid data as well. Run any of the Perl scripts with the --help switch to obtain more help.

Many of the Perl scripts require that the VCF files are compressed by bgzip and indexed by tabix (both tools are part of the tabix package, available for download here). The VCF files can be compressed and indexed using the following commands

bgzip my_file.vcf
tabix -p vcf my_file.vcf.gz

http://vcftools.sourceforge.net/perl_module.html

Address of the bookmark: http://vcftools.sourceforge.net/perl_module.html

Bioinformatics Scripts

Jit — Thu, 22 Jan 2015 22:29:39 -0600

Some of the useful bioinformatics scripts.

For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.

http://milkweedgenome.org/?q=scripts

Address of the bookmark: http://milkweedgenome.org/?q=scripts