Duration : Initially for a period of one year. Extendable based on the performance.

Qualification: (i) MSc in Bioinformatics, Biotechnology, Physics, Biophysics, Biochemistry,Computer Science with NET (UGC/CSIR/GATE/BINC/INSPIRE etc) qualification. (OR) (ii) M. Tech in Bioinformatics, Biotechnology

Additional qualification: Programming skills

Candidates who fulfill the requirements of IIT have the possibility to register for PhD.

Fellowship: Rs.25,000 and HRA.

Applicants are encouraged to send the CV to the coordinator by postal mail and e-mail. The deadline to receive the applications is 31st August 2016. The project coordinator has the discretion to restrict the number of candidates to be called for interview to a reasonable limit on the basis of qualifications and experience higher than the minimum prescribed in the announcement.

Project Co-ordinator:

Dr. M. Michael Gromiha
Department of Biotechnology
Indian Institute of Technology Madras
Chennai 600036
Email: gromiha@iitm.ac.in

The new features include

(i) building gene-based and supermatrix-based phylogenies using a single command,

(ii) testing and visualizing evolutionary models,

(iii) calculating distances between trees of different size or including duplications, and

(iv) providing seamless integration with the NCBI taxonomy database.

ETE is freely available at http://etetoolkit.org

Address of the bookmark: http://etetoolkit.org

More at http://www.web.manit.ac.in/Year%202016/JRF/walk%20in.pdf

Duration of the Project: Six Months from the date of appointment can be extended further for six months
Essential Qualification and Experience: 1st Class Masters Degree in Bioinformatics or Life Sciences equivalent degree from a recognized University with 4 years R&D experience in Bioinformatics or relevant subjects from recognized institutes.
OR
Ph.D. degree in Bioinformatics or Life Sciences from recognized University.
M.Sc. degree obtained after a one year course will not be considered.
Experience: Research/teaching experience in Bioinformatics or relevant subjects form recognized Institute(s).

More at http://www.actrec.gov.in/data%20files/Vacancies/2016/AV-scin-stud-trainee-6-Sept-16.docx

Address of the bookmark: https://github.com/yjx1217/LRSDAY

Note: Experience in the following field required: Molecular cancer cytogenetic and genetic toxicology Molecular drug Designing and targeted therapy Cancer genomics, proteomics, bioinformatics and next generation sequencing Therapeutic stem cell research and gene therapy Molecular cancer immunology and immunotherapy Molecular epidemiology Tumor endocrinology Translation research Ultra structural/tissue engg/development biology research Virus and cancer Molecular pathology No. of Posts: 11 (Eleven), (SC-1, OBC-3, UR-7)

Location: Kolkata (Calcutta) Salary: Rs.15600-39100 + Grade, Pay Rs.5400/-

For details kindly refer to the Employment News dated 24-30 September, 2016 and in the Institute’s Website: http://www.cnci.org.in

Last date for receipt of applications is 30 days from the date of notification in the Employment News. Director Chittaranjan National Cancer Institute 378, S.P.

Institute’s Website: http://www.cnci.org.in

BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.

Address of the bookmark: https://amp.pharm.mssm.edu/biojupies/

Address of the bookmark: https://github.com/lmcai/PhyloHerb/

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

You see, for the past couple of years, I’ve been a bit frustrated because OS X does not come with a whole lot of Perl modules pre-installed, and for all I googled, I couldn’t find an “idiot’s” guide for moderately-savvy-but-not-expert users like myself to install modules and dependencies on demand.

The only instructions I could find point to Fink, which basically installs modules in a path that isn’t included in the Perl @INC variable, meaning you have to manually specify the full path to the modules in every script — which is not a lot of fun if you’re developing on OS X and deploying on Red Hat, for instance.

Moreover, Fink doesn’t seem to make every module available, and it’s not very easy to determine which Fink package you need to install if you need a particular module.

So, with a script that called on several apparently unavailable modules, and a deadline looming, I finally decided to suck it up and figure out how to use CPAN to install them:

1) Make sure you have the Apple Developer Tools (XCode) installed.

These are on one of your install discs, or available as a huge but free download from the Apple Developer Connection [free registration required] or the Mac App Store. I thought I had them, but apparently when we upgraded that computer to Tiger, they went missing.

If you don’t have this stuff installed, your installation will fail with errors about unavailable commands.

1.5) Install Command Line Tools (Recent XCode versions only)

(Thank you to Tom Marchioro for informing me about this step.)

Older versions of XCode installed the command line tools (which are required to properly install CPAN modules) by default, but apparently newer ones do not. To check whether you have the command line tools already installed, run the following from the Terminal:

$ which make

This command checks the system for the “make” tool. If it spits out something like /usr/bin/make you’re golden and can skip ahead to Step 2. If you just get a new prompt and no output, you’ll need to install the tools:

1. Launch XCode and bring up the Preferences panel.
2. Click on the Downloads tab
3. Click to install the Command Line Tools

If you like, you can run which make again to confirm that everything’s installed correctly.

2) Configure CPAN.

$ sudo perl -MCPAN -e shell

perl> o conf init

This will prompt you for some settings. You can accept the defaults for almost everything (just hit “return”). The two things you must fill in are the path to make (which should be /usr/bin/make or the value returned when you run which make from the command line) and your choice of CPAN mirrors (which you actually choose don’t really matter, but it won’t let you finish until you select at least one). If you use a proxy or a very restrictive firewall, you may have to configure those settings as well.

If you skip Step 2, you may get errors about make being unavailable.

3) Upgrade CPAN

$ sudo perl -MCPAN -e 'install Bundle::CPAN'

Don’t forget the sudo, or it’ll fail with permissions errors, probably when doing something relatively unimportant like installing man files.

This will spend a long time downloading, testing, and compiling various files and dependencies. Bear with it. It will prompt you a few times about dependencies. You probably want to enter “yes”. I agreed to everything it asked me, and everything turned out fine. YMMV of course. If everything installs properly, it’ll give you an “OK” at the end.

4) Install your modules. For each module….

$ sudo perl -MCPAN -e 'install Bundle::Name'

or

$ sudo perl -MCPAN -e 'install Module::Name'

This will install the module and its dependencies. Nice, eh? Again, don’t forget the sudo.

The first time you run this after upgrading CPAN, it may prompt you to configure again (see Step 2). If you accept its offer to try to configure itself automatically, it may just run through everything without a problem.

There are a couple of potential pitfalls with specific modules (such as theLWP::UserAgent / HEAD issue), but most have workarounds, and I haven’t run into anything that wasn’t easily recoverable.

And that’s it!

Did you find this useful? Is there anything I missed?