More at http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=12859&cntnt01returnid=83

Address of the bookmark: https://github.com/yjx1217/LRSDAY

http://www.boseinst.ernet.in/advertisement.html

BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.

Address of the bookmark: https://amp.pharm.mssm.edu/biojupies/

Address of the bookmark: https://github.com/lmcai/PhyloHerb/

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

THIRUVANANTHAPURAM - 695 562

Traineeship on Bioinformatics(2)

First class M.Sc. Bioinformatics/ Agriculture/ Botany/ Biotechnology @ Rs.8000

Those candidates who fulfill the above criteria may attend a walk PCC Coordinator in-interview on 28th November 2016 at Saraswathy Thangavelu center, JNTBGRI, Puthenthope, Thiruvananthapuram between at 10.00 am and 2.00 pm with all the relevant document and testimonials.

No TA/DA will be given to candidates for attending the interview.

More Info : http://jntbgri.res.in/downloads/traineeship_notification.pdf

Research Associate :
Essential Qualification: Ph.D in Bioinformatics/Biotechnology/Life Science from a reocngised univeristy/institute
Pay: Rs.36000-/- + Admissible 10% HRA per month
Age: Below 35 years

Junior Research Fellow
Essential Qualification: M.Sc in Bioinformatics/Biotechnology/Life Science from a reocngised univeristy/institute
Pay: Rs.18000-/- + per month
Age: Below 35 years

Last date for receving application by mail or post is 08.11.2016

Company Info.
North-Eastern Hill University

Bioinformatics Infrastructure Facility (BIF) Department of RDAP North-Eastern Hill University, Tura Campus Tura-794002, Meghalaya

More at http://www.nehu.ac.in/Advertisements/BIFTuraManpowerAdvt_25102016.pdf

Position (scale), qualifications and experience

1. Information Officer (Rs 8000-275-13500): one post
Qualifications and experience: MCA, Post-Graduate in any field of biosciences, bioinformatics with at least two years of experience in working in a bioinformatics setup and good knowledge of linux operating system and computer networking.

General terms and conditions:
1. The above engagements is presently till March 31st, 2017. However on extension of project grant and satisfactory performance of the candidate, your services can be extended beyond March 31st, 2017 based on the terms and conditions of extension of project grant.

2. It is not an appointment with the institute and will not confer any right to the incumbent to any claim implicit or explicit on any position.

3.No TA/DA will be paid for attending the interview. Outstation candidates have to make their own arrangement for their stay.

4.Candidates, appearing in the walk-in interview are requested to bring the hard copy of application addressed to Dr. Anju Pappachan with latest photograph, CV mentioning qualifications, work experience and name of two referees and one page write up as to why you would like to join the project.

Address:
Dr. Anju Pappachan
Indian Institute of Advanced Research (IIAR),
University and Institute of Advanced Research,
The Puri Foundation for Education in India,
Koba Institutional Area,
Gandhinagar- 382 007, Gujarat, India. Contact no. 079-30514152
e-mail- anju@iiar.res.in

Address of the bookmark: https://pgapx.ybzhao.com/