<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30744?offset=470</link>
	<atom:link href="https://bioinformaticsonline.com/related/30744?offset=470" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/7913/the-genome-factory</guid>
	<pubDate>Thu, 16 Jan 2014 02:09:31 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/7913/the-genome-factory</link>
	<title><![CDATA[The genome factory !!!]]></title>
	<description><![CDATA[<p>Illumina, Inc. announced Tuesday that its new HiSeq X Ten Sequencing System has broken the &ldquo;sound barrier&rdquo; of human genomics by enabling the $1,000 genome. &ldquo;This platform includes dramatic technology breakthroughs that enable researchers to undertake studies of unprecedented scale by providing the throughput to sequence tens of thousands of human whole genomes in a single year in a single lab,&rdquo; Illumina stated.</p><p>Initial customers for the HiSeq X Ten System, which will ship in Q1 2014, include Macrogen, based in Seoul, South Korea and its CLIA laboratory in Rockville, Maryland, the Broad Institute in Cambridge, Massachusetts, and the Garvan Institute of Medical Research in Sydney, Australia.</p><p>&ldquo;For the first time, it looks like it will be possible to deliver the $1,000 genome, which is tremendously exciting,&rdquo; said Eric Lander, founding director of the Broad Institute and a professor of biology at MIT. &ldquo;The HiSeq X Ten should give us the ability to analyze complete genomic information from huge sample populations. Over the next few years, we have an opportunity to learn as much about the genetics of human disease as we have learned in the history of medicine.&rdquo;</p><p>&ldquo;The HiSeq X Ten is an ideal platform for scientists and institutions focused on the discovery of genotypic variation to enable a deeper understanding of human biology and genetic disease,&rdquo; Illumina stated. &ldquo;It can sequence tens of thousands of samples annually with high-quality, high-coverage sequencing, delivering a comprehensive catalog of human variation within and outside coding regions.&rdquo;</p><p>HiSeq X Ten utilizes a number of advanced design features to generate massive throughput. Patterned flow cells, which contain billions of nanowells at fixed locations, combined with a new clustering chemistry deliver a significant increase in data density (6 billion clusters per run). Using state-of-the art optics and faster chemistry, HiSeq X Ten can process sequencing flow cells more quickly than ever before &mdash; generating a 10x increase in daily throughput when compared to current HiSeq 2500 performance.</p><p>The HiSeq X Ten is sold as a set of 10 or more ultra-high throughput sequencing systems, each generating up to 1.8 terabases (Tb) of sequencing data in less than three days or up to 600 gigabases (Gb) per day, per system, providing the throughput to sequence tens of thousands of high-quality, high-coverage genomes per year. Illumina says the $1,000 includes typical instrument depreciation, DNA extraction, library preparation, and estimated labor.</p>]]></description>
	<dc:creator>Madhvan Reddy</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7999/senior-research-fellow-indian-agricultural-statistics-research-institute</guid>
  <pubDate>Thu, 23 Jan 2014 06:22:15 -0600</pubDate>
  <link></link>
  <title><![CDATA[Senior Research Fellow @ Indian Agricultural Statistics Research Institute]]></title>
  <description><![CDATA[
<p>Indian Agricultural Statistics Research Institute<br />Library Avenue, Pusa, New Delhi – 110012</p>

<p>Walk-in-Interview</p>

<p>Walk-in-interview will be held on February 11, 2014 at 10:00 A.M. at IASRI, New Delhi for a project “Whole Genome Sequencing and Development of Allied Genomics Resources in Two Commercially Important Fish-Labeo rohita and Clarias batrachus” funded by Department of Biotechnology, Ministry of Science and Technology, Government of India, New Delhi for the following posts. The appointment will be on contractual basis upto September, 2016 or till the termination of the project whichever is earlier and the incumbent shall not have any claim for regular appointment under ICAR.</p>

<p>Senior Research Fellow Two</p>

<p>Post-Graduation in Bioinformatics/ Agricultural Statistics/ Statistics/ Computer Science/ Computer Application/ Biotechnology or equivalent with 1st Division</p>

<p> Knowledge of Statistical Analysis /Bioinformatics tools/computer programming for computational genomics.</p>

<p>Emoluments for Research Associate: Consolidated Rs: 16000/- per month + 30% HRA (1st Two years) and Rs: 18000/- per month + 30% HRA (3rd Year)</p>

<p>Age Limit: Age should be not more than 35 years (5 years relaxation for SC/ST/women candidates and 3 years for OBC candidates as on date of interview).<br />Interested candidates are requested to appear for Walk-in-Interview on the date and time as specified above in Room No. 106, Training Cum Administrative Block of the Institute along with their application giving bio-data with attested copies of certificates, degrees, testimonials, etc. and one passport size photograph. Original certificates/ Degrees are needed to be produced at the time of interview. No T.A. /D.A. will be paid for appearing in the interview.</p>

<p>Advertisement: http://www.iasri.res.in/employment/2014/srf_cabin.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8108/jrf-institute-of-cytology-preventive-oncology</guid>
  <pubDate>Sat, 01 Feb 2014 13:47:29 -0600</pubDate>
  <link></link>
  <title><![CDATA[JRF @ Institute of Cytology &amp; Preventive Oncology]]></title>
  <description><![CDATA[
<p>Institute of Cytology &amp; Preventive Oncology (ICPO) which was initially established as Cytology Research Centre ( CRC ) by the Indian Council of Medical Research (ICMR) in 1979, came into the existence in 1989 when CRC was elevated to the level of Institute. ICPO was instituted with the main aim of promoting research in the field of cancers that are most prevalent in India with an emphasis on their early detection and prevention.</p>

<p>Candidates having the below mentioned qualifications may appear for Walk in Interview at ICPO on 5th Feb 2014 between 10.00 AM and 12.00 PM under the NIF project entitled "Prediction of drug tragets of chemical constituents present within non-codified medicinal plants" under Dr Subhash M.Agarwal, Scientist C</p>

<p>    Position : JRF<br />    No of Post : One<br />    Pay : Rs 12000/- + 30% HRA </p>

<p>    Desired Profile : M.Sc in Bioinformatics with good academic record. Candidate with experience in database development and scripting would be preferred<br />    Age Limit : Below 28 years<br />    Period : 2 months</p>

<p>Interested candidates may send their applications with bio-data by email (smagarwal@gmail.com) or post addressed to Dr Subhash M Agarwal, Scientist C, Bioinformatics Division, Institute of Cytology and Preventive Oncology (ICPO) I-7, Sector 39, Noida-201301 so as to reach latest by 04.02.14</p>

<p>Deadline : 04.02.14</p>

<p>http://icmr.nic.in/icmrnews/icpo_jrf.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</guid>
	<pubDate>Wed, 05 Jun 2019 15:04:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</link>
	<title><![CDATA[Bioinformatics for Precision Oncology - Online Training Program, Summer 2019]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/05/OncologyBioinformatics.jpeg" width="600" height="337.5" alt="image" style="border: 0px;"></p><p>The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register:&nbsp;https://edu.t-bio.info/bioinformatics-training-precision-oncology/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/8385/peng-lab</guid>
  <pubDate>Tue, 18 Feb 2014 13:53:46 -0600</pubDate>
  <link></link>
  <title><![CDATA[Peng Lab]]></title>
  <description><![CDATA[
<p>Peng Lab at Janelia Farm Research Campus, Howard Hughes Medical Institute focuses on data mining for bioinformatics and computational molecular biology, particularly, bioimage data mining and informatics. These bioimages include cellular and molecular images and related medical images. </p>

<p>* Analysis of Gene Expression Pattern Images: high-performance image analysis and mining for different model organisms, such as fruitfly, C. elegans, and mouse;<br />* Feature/Model Learning: developing algorithms and software</p>

<p>Location :Janelia Farm Research Campus, Howard Hughes Medical Institute, Ashburn, Virginia, USA.</p>

<p>http://research.janelia.org/peng/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</guid>
	<pubDate>Thu, 24 Oct 2019 10:30:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</link>
	<title><![CDATA[IITM-Tokyo Tech Joint Symposium]]></title>
	<description><![CDATA[<p>The IITM-Tokyo Tech Joint Symposium is a biannual international symposium held in Indian Institute of Technology Madras (IITM), India in collaboration with Tokyo Institute of Technology (Tokyo-Tech), Japan. During the symposium, experts in various domains of Bioinformatics gather from India and Japan under one roof to discuss and present their works. This provides an unique opportunity to the researchers and students to learn the frontiers and interact with eminent scientists in Bioinformatics. The 5th IITM - Tokyo Tech Joint Symposium titled "Current trends in Bioinformatics: Big data analysis, machine learning and drug design", will be held on 6th - 7th March 2020 in IITM, Chennai, India.</p><p>The symposium will focus on topics in the below mentioned areas.</p><p>Topics: Algorithms for biomolecular sequences / structures Bioinformatics databases and tools Protein function Structure based drug design Machine learning Deep learning Large scale data analysis Big Data NGS Analysis Protein interactions/network Molecular modelling/docking/screening Biomolecular structure and function More</p><p>Info: https://web.iitm.ac.in/bioinfo2/symposium2020/home</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8442/assistant-professor-king-saud-university-riyadh</guid>
  <pubDate>Fri, 21 Feb 2014 05:57:18 -0600</pubDate>
  <link></link>
  <title><![CDATA[Assistant Professor @ King Saud University Riyadh]]></title>
  <description><![CDATA[
<p>Qualifications: Candidates must have a Ph.D. and a strong background in Molecular and Cellular Biology, protein expression, FACS, or computational biology, and ability to work collaboratively.</p>

<p>This position will have a significant focus on providing analytical support for next generation sequencing data analysis – Exome-sequencing, Targetted sequencing as well as high-throughput genotyping on Illumina platform.</p>

<p>Job location:</p>

<p>Genome Research Chair<br />King Saud University, Riyadh-11451<br />KSA</p>

<p>Interested candidate may forward their CV to grcksu@gmail.com</p>
]]></description>
</item>

</channel>
</rss>