<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30744?offset=560</link>
	<atom:link href="https://bioinformaticsonline.com/related/30744?offset=560" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/42974/list-of-bioinformatics-packages-for-ngs-analysis</guid>
	<pubDate>Sat, 20 Mar 2021 00:28:51 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/42974/list-of-bioinformatics-packages-for-ngs-analysis</link>
	<title><![CDATA[List of bioinformatics packages for NGS analysis !]]></title>
	<description><![CDATA[<p>Package suites gather software packages and installation tools for specific languages or platforms. We have some for bioinformatics software.</p><ul>
<li><a href="https://github.com/Bioconductor">Bioconductor</a>&nbsp;&ndash; A plethora of tools for analysis and comprehension of high-throughput genomic data, including 1500+ software packages. [&nbsp;<a href="https://link.springer.com/article/10.1186/gb-2004-5-10-r80">paper-2004</a>&nbsp;|&nbsp;<a href="https://www.bioconductor.org/">web</a>&nbsp;]</li>
<li><a href="https://github.com/biopython/biopython">Biopython</a>&nbsp;&ndash; Freely available tools for biological computing in Python, with included cookbook, packaging and thorough documentation. Part of the&nbsp;<a href="http://open-bio.org/">Open Bioinformatics Foundation</a>. Contains the very useful&nbsp;<a href="https://biopython.org/DIST/docs/api/Bio.Entrez-module.html">Entrez</a>&nbsp;package for API access to the NCBI databases. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/19304878">paper-2009</a>&nbsp;|&nbsp;<a href="https://biopython.org/">web</a>&nbsp;]</li>
<li><a href="https://github.com/bioconda">Bioconda</a>&nbsp;&ndash; A channel for the&nbsp;<a href="http://conda.pydata.org/docs/intro.html">conda package manager</a>&nbsp;specializing in bioinformatics software. Includes a repository with 3000+ ready-to-install (with&nbsp;<code>conda install</code>) bioinformatics packages. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/29967506">paper-2018</a>&nbsp;|&nbsp;<a href="https://bioconda.github.io/">web</a>&nbsp;]</li>
<li><a href="https://github.com/BioJulia">BioJulia</a>&nbsp;&ndash; Bioinformatics and computational biology infastructure for the Julia programming language. [&nbsp;<a href="https://biojulia.net/">web</a>&nbsp;]</li>
<li><a href="https://github.com/rust-bio/rust-bio">Rust-Bio</a>&nbsp;&ndash; Rust implementations of algorithms and data structures useful for bioinformatics. [&nbsp;<a href="http://bioinformatics.oxfordjournals.org/content/early/2015/10/06/bioinformatics.btv573.short?rss=1">paper-2016</a>&nbsp;]</li>
<li><a href="https://github.com/seqan/seqan3">SeqAn</a>&nbsp;&ndash; The modern C++ library for sequence analysis.</li>
</ul>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7213/postdoctoral-position-bioinformaticscomputational-biology</guid>
  <pubDate>Thu, 12 Dec 2013 17:58:00 -0600</pubDate>
  <link></link>
  <title><![CDATA[Postdoctoral Position (Bioinformatics/Computational Biology)]]></title>
  <description><![CDATA[
<p>University College Cork<br />LAPTI<br />Cork-Co Cork-Ireland</p>

<p>Postdoctoral position is available for three years to work on development of Bioinformatics resources for the analysis and visualization of ribosome profiling data. Ribosome profiling (ribo-seq) is a technology that allows mapping positions of the ribosomes on the whole transcriptome level with a nucleotide precision. The technology allows obtaining high resolution digital snapshots of gene expression in cells. The position is available starting on the 1st of October, 2013.</p>

<p>Candidate is expected to have Ph.D. in Bioinformatics or Computational Biology. Candidates with the degree in non-Biological disciplines such as Computer Science, Statistics, Applied Mathematics, Physics or Electrical Engineering will also be considered.</p>

<p>The position is available at LAPTI (http://lapti.ucc.ie) that is located in the Western Gate Building (http://www.stwarchitects.com/project-information.php?c=1&amp;p=09993) at University College Cork. Western Gate Building Research Complex hosts several UCC departments and provides ideal environment for interdisciplinary research. Cork (sometimes referenced as “Venice of Ireland”) is the second most populous city in the Republic. It has friendly cosmopolitan atmosphere and vibrant culture. A number of American industrial giants such as Apple , EMC and Pfizer have chosen Cork as a home for their European headquarters.</p>

<p>The details of the application process are given at http://lapti.ucc.ie/jobs.html. To ensure prompt processing of your application use the subject line: ‘Postdoc computational’. All applications received prior to August the 1st are guaranteed equal consideration. However, applications at the later dates will also be considered until the position is filled.</p>

<p>For more info visit http://lapti.ucc.ie</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23121/senior-sas-programmer-urgent-role-permanant-welwyn-garden-city-uk</guid>
  <pubDate>Fri, 03 Jul 2015 08:14:23 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior SAS Programmer - URGENT ROLE - Permanant - Welwyn Garden City - UK]]></title>
  <description><![CDATA[
<p>SAS Programmer URGENTLY required !! My client is looking for an experienced Senior SAS Programmer, to join their bubbly dynamic team in Welwyn Garden City. You must have experience within SAS and/or R programming language. I am looking for someone with a background within either Life Sciences, Statistics, Computer Science, Bioinformatics etc. I am looking for someone with leadership qualities, you must have excellent analyst skills. Please call Dareen Evans on 01772 278050 or email your cv to dareen.evans@itworkshealth.co.uk</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/7288/critical-to-discoveries-in-bioinformatics</guid>
	<pubDate>Mon, 16 Dec 2013 17:13:24 -0600</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/7288/critical-to-discoveries-in-bioinformatics</link>
	<title><![CDATA[Critical to discoveries in bioinformatics]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/MnKvMP8CeSQ" frameborder="0" allowfullscreen></iframe>EMBL-EBI distributes datasets worldwide using the Janet network. This biological data enables the discovery of new drugs, new diagnostics and increasingly new agro-chemicals.  Their work, which includes the 1000-genome project, has generated petabytes of data and this growth is showing no signs of abating.  On-demand bandwidth over Janet will therefore be critical to their ongoing work.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</guid>
	<pubDate>Thu, 07 Dec 2017 08:46:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</link>
	<title><![CDATA[Edit distance application in bioinformatics !]]></title>
	<description><![CDATA[<p>There are other popular measures of&nbsp;<a href="https://en.wikipedia.org/wiki/Edit_distance" title="Edit distance">edit distance</a>, which are calculated using a different set of allowable edit operations. For instance,</p><ul>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance" title="Damerau&ndash;Levenshtein distance">Damerau&ndash;Levenshtein distance</a>&nbsp;allows insertion, deletion, substitution, and the&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>&nbsp;of two adjacent characters;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Longest_common_subsequence_problem" title="Longest common subsequence problem">longest common subsequence</a>&nbsp;(LCS) distance allows only insertion and deletion, not substitution;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Hamming_distance" title="Hamming distance">Hamming distance</a>&nbsp;allows only substitution, hence, it only applies to strings of the same length.</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Jaro_distance" title="Jaro distance">Jaro distance</a>&nbsp;allows only&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>.</li>
</ul><p>&nbsp;</p><pre><span>use</span> Text<span>::</span>Levenshtein <span>qw</span><span>(</span>distance<span>);</span>

 <span>print</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>"four"</span><span>);</span>
 <span># prints "2"</span>

 <span>my</span> <span>@words</span>     <span>=</span> <span>qw</span><span>/ four foo bar /</span><span>;</span>
 <span>my</span> <span>@distances</span> <span>=</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>@words</span><span>);</span>

 <span>print</span> <span>"@distances"</span><span>;</span>
 <span># prints "2 0 3"</span><br /><br /><br /></pre><pre><span>use</span> Algorithm<span>::</span>LCSS <span>qw</span><span>(</span> LCSS CSS CSS_Sorted <span>);</span>
    <span>my</span> <span>$lcss_ary_ref</span> <span>=</span> <span>LCSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array</span>
    <span>my</span> <span>$lcss_string</span>  <span>=</span> <span>LCSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># string</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>    <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>      <span># ref to array of strings</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># ref to array of strings<br /><br /><br /><br /></span></pre><p>There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshteinXS">Text::LevenshteinXS</a>&nbsp;and&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3AXS">Text::Levenshtein::XS</a>&nbsp;are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.</p><p>The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau">Text::Levenshtein::Damerau</a>&nbsp;defaults to using a pure perl implementation, but if you've installed&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau%3A%3AXS">Text::Levenshtein::Damerau::XS</a>&nbsp;then it will be a lot quicker.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AWagnerFischer">Text::WagnerFischer</a>&nbsp;is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ABrew">Text::Brew</a>&nbsp;is an implementation of the Brew edit distance, which is another algorithm based on edit weights.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy">Text::Fuzzy</a>&nbsp;provides a number of operations for partial or fuzzy matching of text based on edit distance.&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy%3A%3APP">Text::Fuzzy::PP</a>&nbsp;is a pure perl implementation of the same interface.</p><p><a href="http://search.cpan.org/perldoc?String%3A%3ASimilarity">String::Similarity</a>&nbsp;takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ADice">Text::Dice</a>&nbsp;calculates&nbsp;<a href="https://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient">Dice's coefficient</a>&nbsp;for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.</p><pre><span>&nbsp;</span></pre>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7483/research-associate-indian-institute-of-spices-research</guid>
  <pubDate>Wed, 25 Dec 2013 12:34:43 -0600</pubDate>
  <link></link>
  <title><![CDATA[Research Associate @ INDIAN INSTITUTE OF SPICES RESEARCH]]></title>
  <description><![CDATA[
<p>INDIAN INSTITUTE OF SPICES RESEARCH<br />(Indian Council of Agricultural Research)<br />Marikunnu P.O., Kozhikode – 673 012, Kerala</p>

<p>WALK -IN- TEST CUM INTERVIEW</p>

<p>Walk- in- Test cum Interview (based on test) for the selection of Research Associate (Bioinformatics) &amp; Bioinformatic Trainees under the scheme ‘Distributed Information Sub Centre- DISC’ will be held at this Institute as per details indicated below.</p>

<p>Research Associate</p>

<p>Date of Interview : 21 -01-2014 at 10.00 A.M</p>

<p>Qualifications : a) Essential: Doctorate degree in Bioinformatics or Biotechnology/Life Sciences/Biochemistry with expertise in  Bioinformatics as evidenced by publications.</p>

<p>OR</p>

<p>Three years research experience after MVSc/MPharm/ME/MTech with Bioinformatics  Specialization.</p>

<p>b Desirable: Experience in handling NGS data  Programming skills in Python/Bioperl</p>

<p>Emoluments : Rs:22000/- per month + HRA (higher pay upto Rs.24000/- can be paid  depending on the qualifications and experience.</p>

<p>Upper age limit : 40 years for Men &amp; 45 years for Women as on date of Interview (Upper Age limits are relaxable for SC, ST and OBC candidates as per Govt. of India norms (at present 5 years for SC/ST and 3 years for OBC)</p>

<p>Duration of Project : Till the closure of the project.</p>

<p>General Terms and conditions</p>

<p>1. The above positions are purely on temporary basis and is co-terminus with the closure of the project. There is no provision of re-employment after termination of project. The selected candidate will not have any right for claiming pay scale or absorption against any regular post being vacant on a later date at this Institute.<br />2 . No TA/DA will be paid for attending the Interview.<br />3. Canvassing in any form will lead to cancellation of candidate.<br />4. The decision of Director, IISR would be final and binding in all aspects.<br />5. Candidates will not be permitted to enter the Examination Hall after 10.00 A.M.<br />6. Candidates who secure the minimum marks prescribed by the Institute in written test  only will be eligible for calling for the interview. The number of candidates to be  called for the interview will be decided by the Director of the Institute.<br />7 Those who do not possess original Degree/PG certificate or Provisional certificate will not be allowed to attend the Test/Interview.</p>

<p>Note: All relevant certificates (in original) and bio data<br />No objection certificate in case he/she is employed elsewhere and experience certificate in original (if any) need to be produced at the time of interview.<br />Location of IISR Kozhikode Main Campus - Pallithazham bus stop between Moozhikkal East and Chelavoor on the NH 212 ”Kozhikode - Kollegal” Road.</p>

<p>Advertisement:  www.spices.res.in/pdf/DISC-Website.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/7913/the-genome-factory</guid>
	<pubDate>Thu, 16 Jan 2014 02:09:31 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/7913/the-genome-factory</link>
	<title><![CDATA[The genome factory !!!]]></title>
	<description><![CDATA[<p>Illumina, Inc. announced Tuesday that its new HiSeq X Ten Sequencing System has broken the &ldquo;sound barrier&rdquo; of human genomics by enabling the $1,000 genome. &ldquo;This platform includes dramatic technology breakthroughs that enable researchers to undertake studies of unprecedented scale by providing the throughput to sequence tens of thousands of human whole genomes in a single year in a single lab,&rdquo; Illumina stated.</p><p>Initial customers for the HiSeq X Ten System, which will ship in Q1 2014, include Macrogen, based in Seoul, South Korea and its CLIA laboratory in Rockville, Maryland, the Broad Institute in Cambridge, Massachusetts, and the Garvan Institute of Medical Research in Sydney, Australia.</p><p>&ldquo;For the first time, it looks like it will be possible to deliver the $1,000 genome, which is tremendously exciting,&rdquo; said Eric Lander, founding director of the Broad Institute and a professor of biology at MIT. &ldquo;The HiSeq X Ten should give us the ability to analyze complete genomic information from huge sample populations. Over the next few years, we have an opportunity to learn as much about the genetics of human disease as we have learned in the history of medicine.&rdquo;</p><p>&ldquo;The HiSeq X Ten is an ideal platform for scientists and institutions focused on the discovery of genotypic variation to enable a deeper understanding of human biology and genetic disease,&rdquo; Illumina stated. &ldquo;It can sequence tens of thousands of samples annually with high-quality, high-coverage sequencing, delivering a comprehensive catalog of human variation within and outside coding regions.&rdquo;</p><p>HiSeq X Ten utilizes a number of advanced design features to generate massive throughput. Patterned flow cells, which contain billions of nanowells at fixed locations, combined with a new clustering chemistry deliver a significant increase in data density (6 billion clusters per run). Using state-of-the art optics and faster chemistry, HiSeq X Ten can process sequencing flow cells more quickly than ever before &mdash; generating a 10x increase in daily throughput when compared to current HiSeq 2500 performance.</p><p>The HiSeq X Ten is sold as a set of 10 or more ultra-high throughput sequencing systems, each generating up to 1.8 terabases (Tb) of sequencing data in less than three days or up to 600 gigabases (Gb) per day, per system, providing the throughput to sequence tens of thousands of high-quality, high-coverage genomes per year. Illumina says the $1,000 includes typical instrument depreciation, DNA extraction, library preparation, and estimated labor.</p>]]></description>
	<dc:creator>Madhvan Reddy</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7999/senior-research-fellow-indian-agricultural-statistics-research-institute</guid>
  <pubDate>Thu, 23 Jan 2014 06:22:15 -0600</pubDate>
  <link></link>
  <title><![CDATA[Senior Research Fellow @ Indian Agricultural Statistics Research Institute]]></title>
  <description><![CDATA[
<p>Indian Agricultural Statistics Research Institute<br />Library Avenue, Pusa, New Delhi – 110012</p>

<p>Walk-in-Interview</p>

<p>Walk-in-interview will be held on February 11, 2014 at 10:00 A.M. at IASRI, New Delhi for a project “Whole Genome Sequencing and Development of Allied Genomics Resources in Two Commercially Important Fish-Labeo rohita and Clarias batrachus” funded by Department of Biotechnology, Ministry of Science and Technology, Government of India, New Delhi for the following posts. The appointment will be on contractual basis upto September, 2016 or till the termination of the project whichever is earlier and the incumbent shall not have any claim for regular appointment under ICAR.</p>

<p>Senior Research Fellow Two</p>

<p>Post-Graduation in Bioinformatics/ Agricultural Statistics/ Statistics/ Computer Science/ Computer Application/ Biotechnology or equivalent with 1st Division</p>

<p> Knowledge of Statistical Analysis /Bioinformatics tools/computer programming for computational genomics.</p>

<p>Emoluments for Research Associate: Consolidated Rs: 16000/- per month + 30% HRA (1st Two years) and Rs: 18000/- per month + 30% HRA (3rd Year)</p>

<p>Age Limit: Age should be not more than 35 years (5 years relaxation for SC/ST/women candidates and 3 years for OBC candidates as on date of interview).<br />Interested candidates are requested to appear for Walk-in-Interview on the date and time as specified above in Room No. 106, Training Cum Administrative Block of the Institute along with their application giving bio-data with attested copies of certificates, degrees, testimonials, etc. and one passport size photograph. Original certificates/ Degrees are needed to be produced at the time of interview. No T.A. /D.A. will be paid for appearing in the interview.</p>

<p>Advertisement: http://www.iasri.res.in/employment/2014/srf_cabin.pdf</p>
]]></description>
</item>

</channel>
</rss>