Most people who have a balanced translocation have the right amount of chromosome material but it has been rearranged in some way. This may happen if two chromosomes swap pieces (a reciprocal translocation). In other cases two whole chromosomes may become stuck together (a Robertsonian translocation). This page describes what happens when someone has a reciprocal translocation.

Reciprocal chromosomal translocations occur following double-strand breaks (DSBs) in DNA when a section of one chromosome is exchanged with that of another, non-homologous chromosome. These exchanges may produce a dysfunctional fusion gene that disrupts cell growth and survival pathways, such as the translocations seen in leukemia and childhood sarcomas.

Chromosomal translocations have been well studied in cancer cell lines which are associated with two types of cancer, acute myeloid leukemia and Ewing's sarcoma, but determining how they contribute to cancer development is complicated by additional mutations and altered gene expression profiles in these cultured cells. Now, Juan Carlos Ramirez, head of the Viral Vector Facility at the Fundacion Centro Nacional de Investigaciones Cardiovasculares (CNIC) and his colleagues Raul Torres at CNIC and Sandra Rodriguez-Peralez at the Spanish National Cancer Center (CNIO) in Madrid, Spain have used a new genome editing tool, CRISPR-Cas9, to induce chromosomal translocations for the first time in a human cell line and in primary cells. The study's authors conclude by stating that the use of this technology will allow for the clarification of how and why chromosomal translocation occurs, which without doubt will allow new anti-cancer therapeutic strategies to be tackled.

Using RNA-Guided Endonuclease (RGEN) technology or CRISPR/Cas9 genome engineering technology, CNIO and CNIC researchers have shown that it is possible to obtain such chromosomal translocations. The CRISPR-Cas9 system is extremely simple to introduce a cut at the desired locus, easier to design, and cheaper than many other systems. Using the CRISPR-Cas9 system, Ramirez and his colleagues reproduced the translocations observed in Ewing’s Sarcoma (ES) and Acute Myeloid Leukemia (AML) patient cell lines in HEK293 cells and also generated the ES translocation in human mesenchymal stem cells and the AML translocation in umbilical cord blood cells.

By focusing on chromosomal translocation without the confounding characteristics of established cell lines, these new cells lines should help answer the fundamental question of what causes a cell to become cancerous. Ramirez and his team now look forward to modeling other chromosome translocations in a variety of cell types.

Reference:

http://en.wikipedia.org/wiki/Chromosomal_translocation

http://www.nature.com/ncomms/2014/140603/ncomms4964/abs/ncomms4964.html

The developers and expert trainers are the authors of several popular R packages, including ggplot2, plyr, lubridate, and others.

More at http://www.rstudio.com/

http://www.rstudio.com/products/RStudio/

Address of the bookmark: http://www.rstudio.com/

For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.

http://milkweedgenome.org/?q=scripts

Address of the bookmark: http://milkweedgenome.org/?q=scripts

http://www.tau.ac.il/~itaymay/cp/chromEvol/about.html

Address of the bookmark: http://www.tau.ac.il/~itaymay/cp/chromEvol/downloads.html

If you currently use a spreadsheet like Microsoft Excel for data analysis, you might be interested in taking a look at this tutorial on how to transition from Excel to R by Tony Ojeda. The tutorial explains how to use R functions in place of Excel formulas, including tools like =AVERAGE and =VLOOKUP. For the most part, it uses modern R packages to keep the R code clear and concise.

You'll likely still be using Excel as a data source, though, so you'll also want to check out this guide to importing data from Excel to R from MilanoR.

Reference http://www.r-bloggers.com/an-r-tutorial-for-microsoft-excel-users/

• Function(data, options)

Even quit is a function

• q()

So is help

help(read.table)

Provides the help page for the FUNCTION ‘read.table’

help.search(“t test”)

Searches for help pages that might relate to the phrase ‘t test’

NOTE: quotes are needed for search strings, they are not needed when referring to data objects or function names.

There is a short cut for help,

? shows the help page on a function name, same as help(function)

?read.table

?? searches for help pages on functions, same as help.search(‘phrase’)

??“t test”

Information is usually returned from a function, by default this is printed to screen

read.table(‘data.tsv’)

This can always be stored, we call what it is stored in an ‘object’

mydata

here mydata is an object of type dataframe

Reminder:

• Vector: a list of numbers, equivalent to a column in a table
• Data Frame = a collection of vectors. Equivalent to a table

Hint:

• Up/Down arrow keys can be use to cycle through previous commands

Code in almost all popular languages using Coding Ground. Edit, compile, execute and share your projects, 100% cloud.

http://www.tutorialspoint.com/codingground.htm

Address of the bookmark: http://www.tutorialspoint.com/codingground.htm

We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics.

More at http://millslab.ccmb.med.umich.edu/index.html

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}