BOL: Related items

Amity University Bioinformatics Summer Program - Kolkata

eliabrodsky — Tue, 11 Jun 2019 21:27:10 -0500

Registrations are now open for the 2019 Summer Bioinformatics Training program at Amity University, Kolkata. The program will focus on introductory topics for life science students. We will review important history, topics and challenges bioinformatics can help address in the context of basic research, discovery and industry.

Read more: https://edu.t-bio.info/amity-university-summer-bioinformatics-program-registrations-are-open/

R programming and Jobs website

Pragati Singh — Sun, 25 May 2014 14:43:57 -0500

Welcome to the R Jobs section of ProgrammingR.com. If your organization has an R employment opportunity that you would like to have posted here, submit it via the contact page. Prospective employees: use the contact information provided in the position listing to apply or contact the hiring organization.

Address of the bookmark: http://www.programmingr.com/category/stype/r-job-listings/

GrapheR !!!

John Parker — Thu, 14 Aug 2014 14:02:17 -0500

What a wonderful gem GrapheR is.... Oh yes it is. GrapheR is a GUI for base graphics in R by http://www.maximeherve.com/. The package provides a graphical user interface for creating base charts in R. It is ideal for beginners in R, as the user interface is very clear and the code is written along side into a text file, allowing users to recreate the charts directly in the console.

Adding and changing legends? Messing around with the plotting window settings? It is much easier/quicker with this GUI than reading the help file and trying to understand the various parameters.
Here is a little example using the iris data set.

library(GrapheR)
data(iris)
run.GrapheR()

This will bring up a window that helps me to create the chart and tweak the various parameters.

Finally, I find the underlying R code in a file created by GrapheR. For more details read also the package vignette, which is available in English, French and German!

Nieduszynski Group

Fri, 26 Sep 2014 19:35:06 -0500

Complete, accurate replication of the genome is essential for life. All chromosomes in eukaryotic cells must be duplicated and then segregated to daughter cells to ensure genetic integrity and produce the large number of cells that make up a multicellular organism. We are using genetic, genomic and computational methods to understand how chromosome replication is regulated to ensure genome stability. By focusing on the basic biology that underpins cell growth and division we aim to provide new insights that may help our understanding of diseases such as cancer and congenital disorders.

More http://www.nieduszynski.org/index.php
http://www.path.ox.ac.uk/research/cell-biology-and-pathology/conrad-nieduszynski-group

A 3D Map of the Human Genome

Fri, 12 Dec 2014 22:27:55 -0600

Suhas Rao and Miriam Huntley (of the Aiden Lab) describe a 3D map of the human genome at kilobase resolution, revealing the principles of chromatin looping. Guest Origami Folding: Sarah Nyquist. Suhas S.P. Rao*, Miriam H. Huntley*, Neva C. Durand, Elena K. Stamenova, Ivan D. Bochkov, James T. Robinson, Adrian L. Sanborn, Ido Machol, Arina D. Omer, Eric S. Lander, Erez Lieberman Aiden. (2014). A 3D Map of the Human Genome at Kilobase Resolution Reveals Principles of Chromatin Looping. Cell.

A guide for complete R beginners !

Archana Malhotra — Fri, 20 Feb 2015 23:36:46 -0600

This tutorial is intended to introduce users quickly to the basics of R, focusing on a few common tasks that biologists need to perform some basic analysis: load a table, plot some graphs, and perform some basic statistics. More extensive tutorials can be found on the project website and via bioconductor (not covered here).

R-language: http://www.r-project.org

BioConductor: http://www.bioconductor.org

Advantages of R

Free!
Powerful, many libraries have been created to perform application specific tasks. e.g. analysis of microarray experiments and Next-Gen sequencing (bioconductor: including Bioseq group).
Presentation quality graphics
- Save as a png, pdf or svg
History
- What you do can be saved for the next time you use R.
- Ability to turn it into an automated script to perform again and again on different data

Disadvantages

Lack of a comprehensive graphical user interface, but two do exist: However some do exist: R commander: http://socserv.mcmaster.ca/jfox/Misc/Rcmdr/ and Limma-gui (microarrays) : http://bioinf.wehi.edu.au/limmaGUI/

Preparation

(Optional) Download and save the tutorial data set from
- http://bioinformatics.knowledgeblog.org/wp-content/uploads/bioinf/kerr/data.tsv
- Start R (type R on a Linux or Mac terminal, or find the starting link from PC)

Getting More Help

Project Home page
- http://www.r-project.org/
- Check out the ‘introduction to R’, which is a much more in depth guide .
- Also R has a built-in help system (see later)

Working directory

This is the directory used to store your data and results. It is useful if it is also the directory where your input data is stored.

Mac/Linux: this is the directory where you typed in R
PC: Change using the change working directory option

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Ryan E. Mills Lab

Tue, 26 May 2015 09:29:24 -0500

Our research group is primarily focused on the analysis of whole genome sequence data to identify genetic variation (primarily structural variation) and examine their potential functional impact in disease phenotypes. We are particularly interested in analyzing complex regions of the genome that are not easily resolved through modern sequencing approaches and which may exhibit interesting mechanistic origins.

We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics.

More at http://millslab.ccmb.med.umich.edu/index.html

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Clump Finding Problem Solved with Perl

Jit — Wed, 10 Jun 2015 00:17:17 -0500

The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl