EMBASSY applications are described in separate documentation for each package.

Applications in the current release

Address of the bookmark: http://emboss.sourceforge.net/apps/release/6.6/emboss/apps/

Fellowship: Rs. 18,000/- per month (fixed)

Duration : 2 (Two) years and may be extended
depending on status of the project

Age Limit: Candidates should not be more than 32 years of
age in case of SRF and 28 years of age in case of JRF and TA. Upper age limit may be relaxed up to 5
years in the case of candidate belonging to SC/ ST/ OBC/ Women/ Differently abled.

How to Apply:
Interested candidates may send their application on plain paper by post along with his/her educational
qualifications, research experience certificates (for SRF), 02 copies of recent passport/stamp size photographs
and contact phone number to Professor D.K Bhattacharyya, Principal Investigator, Department of Computer
Science & Engineering, Tezpur University, Napaam – 784 028, or mail it to dkb@tezu.ernet.in
(or to smh@tezu.ernet.in) within 15 days of publication of this advertisement.

No TA/DA shall
be paid for attending the interview.

For more details: http://www.tezu.ernet.in/ProjectWalkin/Advt-DoRD-CSE-DKB-20-225-6779-A.pdf

Address of the bookmark: https://github.com/yjx1217/LRSDAY

WALK-IN INTERVIEW

JIP/PSM/INDO-US TB/ 2016/

Walk-in-interview for the following vacant posts funded by Department of Biotechnology, Govt.of India for the project entitled “Biomarkers for Risk of Tuberculosis and for Tuberculosis Treatment Failure and Relapse” in the Department of Preventive & Social Medicine, JIPMER, Puducherry.

3. Technical Assistant

MCA/ MSc in Biostatistics/ MSc in Computational Biology from any recognized University @ Rs.23,220 1

Interested candidates may attend the walk-in interview with written screening test on 07, September 2016 at 9.30 A.M in the Dept. of Preventive and Social Medicine, IV Floor, Administrative Block, JIPMER.

The applicants are requested to bring the filled in application form and bio-data with original certificates for verification.

More Info: http://jipmer.edu.in/wp-content/uploads/2016/09/RECRUITEMENTsite-protocol-7.9.2016.pdf

BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.

Address of the bookmark: https://amp.pharm.mssm.edu/biojupies/

Address of the bookmark: https://github.com/lmcai/PhyloHerb/

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

kallisto

There are common options for most BBMap suite programs and depending on the file extension the input/output format is automatically chosen/set.

Using BBMap

Mapping Nanopore reads

BBMap.sh has a length cap of 6kbp. Reads longer than this will be broken into 6kbp pieces and mapped independently.

More at https://www.biostarhandbook.com/tools/bbmap/bbmap-help.html

Address of the bookmark: https://www.biostarhandbook.com/tools/bbmap/bbmap-help.html

Beagle version 4.1 has a more accurate genotype phasing algorithm and a very fast and accurate genotype imputation algorithm. Version 4.1 also has several changes to the command line arguments which are described in the release notes. The "ped" argument has no effect in version 4.1. If your data contains nuclear families and you want to model the parent-offspring relationships when phasing genotypes, please use version 4.0.

If you use Beagle 4.1 in a published analysis, please report the program version and cite the appropriate article.

The citation for Beagle's phasing algorithm is:

S R Browning and B L Browning (2007) Rapid and accurate haplotype phasing and missing data inference for whole genome association studies by use of localized haplotype clustering. Am J Hum Genet 81:1084-1097.doi:10.1086/521987

The citation for Beagle's genotype imputation algorithm is:

B L Browning and S R Browning (2016). Genotype imputation with millions of reference samples. Am J Hum Genet 98:116-126.doi:10.1016/j.ajhg.2015.11.020

The citation for Beagle's IBD detection algorithm is:

B L Browning and S R Browning (2013). Improving the accuracy and efficiency of identity-by-descent detection in population data. Genetics 194(2):459-71.doi:10.1534/genetics.113.150029

Address of the bookmark: http://faculty.washington.edu/browning/beagle/beagle.html