BOL: Related items

Research Fellows at AIMSCS, Hyderabad

Wed, 06 May 2015 06:23:33 -0500

C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS) - Hyderabad, Andhra Pradesh
Advertisement No.: 5/2015

Research Fellows Systems Biology job vacancy in C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS)

JRF : Qualification - M. Sc in Bioinformatics, Systems Biology, M. Sc statistics, or M. Tech in Bioinformatics,

Pay Scale : Rs. 25,000

SRF : Qualification- Qualification prescribed for JRF with 2 years of research experience.

Pay Scale : Rs. 28,000*

No.of Post: 2

Desirable: Candidates should have strong background in Computational biology, bioinformatics, statistics and algorithmic development. In addition to that previous experience of working on Linux, bio-informatics, NGS data analysis and Basic knowledge of biology is desirable. Programming on any one of the programming languages (C, C++, perl, python) and statistical framework (e.g. R, matlab, etc.) is highly desirable.

More at http://www.crraoaimscs.org/jrf_application_form_2015.pdf

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Ryan E. Mills Lab

Tue, 26 May 2015 09:29:24 -0500

Our research group is primarily focused on the analysis of whole genome sequence data to identify genetic variation (primarily structural variation) and examine their potential functional impact in disease phenotypes. We are particularly interested in analyzing complex regions of the genome that are not easily resolved through modern sequencing approaches and which may exhibit interesting mechanistic origins.

We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics.

More at http://millslab.ccmb.med.umich.edu/index.html

Rosenberg lab

Wed, 27 May 2015 17:52:24 -0500

Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

JRF Bioinformatics @ ICAR - National Research Centre for Orchids Pakyong

Thu, 28 May 2015 19:33:19 -0500

ICAR - National Research Centre for Orchids

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}