<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/30976?offset=1370</link>
	<atom:link href="https://bioinformaticsonline.com/related/30976?offset=1370" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/2041/uk-genome-science-meeting-sept-2nd-4th-2013</guid>
	<pubDate>Mon, 12 Aug 2013 12:03:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/2041/uk-genome-science-meeting-sept-2nd-4th-2013</link>
	<title><![CDATA[UK Genome Science Meeting, sept 2nd-4th, 2013]]></title>
	<description><![CDATA[<p>Following the success of the last three years' UK Next Gen Sequencing meetings at Nottingham, the newly named UK Genome Science meeting aims to bring together experts from around the world to meet and discuss the current and future state of all aspects and applications of Next Generation Sequencing.</p><p>More at &gt;&gt;&nbsp;<a href="http://www.nottingham.ac.uk/deepseq/events.aspx">http://www.nottingham.ac.uk/deepseq/events.aspx</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/4003/personalised-medicine-animation</guid>
	<pubDate>Tue, 27 Aug 2013 10:07:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/4003/personalised-medicine-animation</link>
	<title><![CDATA[Personalised Medicine - Animation]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/fEY3Khsmuak" frameborder="0" allowfullscreen></iframe>Two animated case scenarios set now and in the future. These highlight potential differences in the way patients are treated now, and how they might be treated as healthcare becomes more tailored.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4552/imtech-lab</guid>
  <pubDate>Sun, 15 Sep 2013 09:41:04 -0500</pubDate>
  <link></link>
  <title><![CDATA[IMTECH Lab]]></title>
  <description><![CDATA[
<p>Computer Aided Protein Structure Prediction; Identification of Vaccine<br />Candidates (T-Epitope prediction); Analysis of Nucleotide/Protein Sequences; Development of Web Server/</p>

<p>Software; Creation of Public Domain Resources in Biology<br />Present Status::</p>

<p>Developing prediction methods for gene, beta-turn, secondary structure and MHC-binding sites.<br />Area of Interest ::</p>

<p>Comparison of force field simulations. Analysis of DNA-protein interactions using molecular mechanics methods.Drug Target Identification using in silico biology.</p>

<p>More @ http://www.imtech.res.in/bic/index.php?option=com_content&amp;view=article&amp;id=65</p>

<p>PIs: http://www.imtech.res.in/bic/index.php?option=com_content&amp;view=article&amp;id=69</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</guid>
	<pubDate>Wed, 05 Jun 2019 15:04:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</link>
	<title><![CDATA[Bioinformatics for Precision Oncology - Online Training Program, Summer 2019]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/05/OncologyBioinformatics.jpeg" width="600" height="337.5" alt="image" style="border: 0px;"></p><p>The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register:&nbsp;https://edu.t-bio.info/bioinformatics-training-precision-oncology/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/view/2023</guid>
	<pubDate>Mon, 12 Aug 2013 09:36:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/view/2023</link>
	<title><![CDATA[What is the objective of BINC examination?]]></title>
	<description><![CDATA[<p>I personally did not understand the objective behind BINC examination. Is government only try to show off that they are doing something to promote Indian bioinformatics sector?</p><p>Moreover, It looks like BINC indirectly putting&nbsp;an extra burden to bioinformatician, mentally and financially.</p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</guid>
	<pubDate>Thu, 24 Oct 2019 10:30:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</link>
	<title><![CDATA[IITM-Tokyo Tech Joint Symposium]]></title>
	<description><![CDATA[<p>The IITM-Tokyo Tech Joint Symposium is a biannual international symposium held in Indian Institute of Technology Madras (IITM), India in collaboration with Tokyo Institute of Technology (Tokyo-Tech), Japan. During the symposium, experts in various domains of Bioinformatics gather from India and Japan under one roof to discuss and present their works. This provides an unique opportunity to the researchers and students to learn the frontiers and interact with eminent scientists in Bioinformatics. The 5th IITM - Tokyo Tech Joint Symposium titled "Current trends in Bioinformatics: Big data analysis, machine learning and drug design", will be held on 6th - 7th March 2020 in IITM, Chennai, India.</p><p>The symposium will focus on topics in the below mentioned areas.</p><p>Topics: Algorithms for biomolecular sequences / structures Bioinformatics databases and tools Protein function Structure based drug design Machine learning Deep learning Large scale data analysis Big Data NGS Analysis Protein interactions/network Molecular modelling/docking/screening Biomolecular structure and function More</p><p>Info: https://web.iitm.ac.in/bioinfo2/symposium2020/home</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/2425/phd-fellowship-computational-biologybioinformatics-cork-ireland-cork-ireland</guid>
  <pubDate>Thu, 15 Aug 2013 14:09:00 -0500</pubDate>
  <link></link>
  <title><![CDATA[Ph.D. Fellowship (Computational Biology/Bioinformatics) : Cork, Ireland : Cork, Ireland]]></title>
  <description><![CDATA[
<p>Ph.D. Fellowship (18,000 euro/pa, plus tuition fees at the EU students rate) is available for four years to work on development of Bioinformatics resources for the analysis and visualization of ribosome profiling data. Ribosome profiling (ribo-seq) is a technology that allows mapping positions of the ribosomes on the whole transcriptome level with a nucleotide precision. The technology allows obtaining high resolution digital snapshots of gene expression in cells. The position is available starting on the 1st of October, 2013.</p>

<p>Candidate:<br />The candidate is expected to have B.S. or M.S. degree in the disciplines such as Computer Science, Statistics, Applied Mathematics, Physics or Electrical Engineering. The candidates with the backgrounds in Life Science disciplines such as Bioinformatics, Computational or Quantitative Biology will also be considered.</p>

<p>Location:<br />The position is available at LAPTI (http://lapti.ucc.ie) that is located in the Western Gate Building (http://www.stwarchitects.com/project-information.php?c=1&amp;p=09993) at University College Cork. Western Gate Building Research Complex hosts several UCC departments and provides ideal environment for interdisciplinary research. Cork (sometimes referenced as “Venice of Ireland”) is the second most populous city in the Republic. It has friendly cosmopolitan atmosphere and vibrant culture. A number of American industrial giants such as Apple , EMC and Pfizer have chosen Cork as a home for their European headquarters.</p>

<p>Application process:<br />The details of the application process are given at http://lapti.ucc.ie/jobs.html. To ensure prompt processing of your application use the subject line: ‘Ph.D. computational’. All applications received prior to August the 1st are guaranteed equal consideration. However, applications at the later dates will also be considered until the position is filled.</p>
]]></description>
</item>

</channel>
</rss>